ID: 911658881

View in Genome Browser
Species Human (GRCh38)
Location 1:100477005-100477027
Sequence TGCATTTTAAAGATGGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911658878_911658881 8 Left 911658878 1:100476974-100476996 CCGATGTGATGACTGAAACAGAT No data
Right 911658881 1:100477005-100477027 TGCATTTTAAAGATGGAGTAAGG No data
911658877_911658881 24 Left 911658877 1:100476958-100476980 CCATTTAGAGGAGAAGCCGATGT No data
Right 911658881 1:100477005-100477027 TGCATTTTAAAGATGGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911658881 Original CRISPR TGCATTTTAAAGATGGAGTA AGG Intronic
No off target data available for this crispr