ID: 911658956

View in Genome Browser
Species Human (GRCh38)
Location 1:100478147-100478169
Sequence GACACATTTGGGATTCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911658956_911658959 -2 Left 911658956 1:100478147-100478169 CCATTCTGAATCCCAAATGTGTC 0: 1
1: 0
2: 1
3: 16
4: 245
Right 911658959 1:100478168-100478190 TCTTCTATCAAACATCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911658956 Original CRISPR GACACATTTGGGATTCAGAA TGG (reversed) Intronic
904423901 1:30411042-30411064 GAAACATTTGGGATTCTGGAAGG - Intergenic
904424435 1:30414411-30414433 GACACCTTTGGGAAGCAGAGAGG + Intergenic
906247621 1:44288207-44288229 GTCAGACATGGGATTCAGAATGG - Intronic
906281529 1:44557726-44557748 AACACATTTGGGATGAATAAAGG - Intronic
907779499 1:57552928-57552950 GACACATTTGGGATATATTAAGG + Intronic
910760028 1:90724311-90724333 GAAACATTTGGCAATAAGAAGGG + Intergenic
911584103 1:99670267-99670289 AACTCATTTGGTATTCACAAAGG - Intronic
911658956 1:100478147-100478169 GACACATTTGGGATTCAGAATGG - Intronic
912214071 1:107587311-107587333 TGCAGATTTGGGATTCAGCAGGG + Intronic
913670073 1:121088967-121088989 CACACATCTGGCATCCAGAAAGG - Intronic
914021838 1:143876365-143876387 CACACATCTGGCATCCAGAAAGG - Intergenic
914660324 1:149784316-149784338 CACACATCTGGCATCCAGAAAGG - Intronic
914717854 1:150266727-150266749 GAGATATCTGGGAGTCAGAAAGG - Intronic
914830052 1:151164704-151164726 GTCAGATTTGGGATTCAAACAGG - Intronic
915854427 1:159366659-159366681 GGCACCTTTGGAATACAGAAAGG - Intergenic
918835561 1:189460332-189460354 GAGACATGTGGCTTTCAGAAAGG - Intergenic
919371328 1:196730715-196730737 GAAACATTTAGGAATCTGAATGG - Intronic
920172111 1:204078600-204078622 GACACATCCGGGTTCCAGAAAGG - Intronic
921658493 1:217769743-217769765 GAAACATTAGGGATTCACAAAGG - Intronic
922653135 1:227358141-227358163 GTCATATTGGGGATTCAGCAGGG - Intergenic
924603119 1:245508761-245508783 GATACATTTGGGACTCAGAAAGG - Intronic
1062988280 10:1790420-1790442 GACACATTTGGGAACCAGGCAGG + Intergenic
1065035605 10:21635659-21635681 TTTATATTTGGGATTCAGAAAGG + Intronic
1065208179 10:23376673-23376695 GAGGCATTTGGCCTTCAGAAGGG + Intergenic
1067508022 10:46872989-46873011 GACAGAGCTGGGATTCAGATTGG + Intergenic
1069051994 10:63804681-63804703 AACACATTTGGGAGGTAGAAGGG - Intergenic
1069585747 10:69600578-69600600 GACACATTAAGGATGCAGAGTGG + Intergenic
1070118146 10:73549307-73549329 TACAAATTTGGAATTCAGGAGGG - Intronic
1070344553 10:75529238-75529260 TACAGAATTGGGATTCAGAAGGG + Intronic
1071102173 10:82051447-82051469 GGCACATTTGGGTTTCAGGTAGG - Intronic
1073870095 10:107853454-107853476 GAAAAATCTGAGATTCAGAAAGG - Intergenic
1074217376 10:111398971-111398993 GACAAAATTGGGACTCCGAAGGG + Intergenic
1074376421 10:112944490-112944512 GAAACATTTGGGATTTTGCAAGG + Intergenic
1075924043 10:126236107-126236129 AACACATTTGCGAGTTAGAAGGG + Intronic
1077636120 11:3841940-3841962 GACAGATTTGAGGCTCAGAAAGG - Intergenic
1078486265 11:11726164-11726186 CACACATTTCTCATTCAGAAAGG - Intergenic
1078783600 11:14464134-14464156 GATACACTTGGAGTTCAGAATGG - Intronic
1079184557 11:18224734-18224756 TATAGATTTGGGATTCAGAGAGG + Intronic
1079311265 11:19368039-19368061 GCCAGATTTGGGGATCAGAAGGG + Intronic
1082985574 11:59167658-59167680 GACACAGTTAAGATACAGAATGG - Intergenic
1084765269 11:71304247-71304269 AAGACCTTAGGGATTCAGAAAGG - Intergenic
1085746153 11:79116000-79116022 GATAAATTTGGGTTTCTGAAAGG - Intronic
1088451520 11:109986330-109986352 CACATAATTGTGATTCAGAATGG + Intergenic
1089367234 11:117928373-117928395 AACACATTGGGGGTGCAGAATGG + Intronic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1095384680 12:41636934-41636956 GACAGATTGGGGATTCAATAAGG - Intergenic
1095392700 12:41728102-41728124 TAAACATTGGAGATTCAGAAGGG + Intergenic
1095926083 12:47580498-47580520 GGCACATATTAGATTCAGAAGGG + Intergenic
1098059011 12:66540175-66540197 GAAACATTTGGGAGTAAAAATGG - Intronic
1098669077 12:73201756-73201778 GTCACATTTGTGATTTATAAAGG - Intergenic
1098722685 12:73922842-73922864 GACAGAGTTAGCATTCAGAAAGG - Intergenic
1099258552 12:80346791-80346813 GAGACATTTGGGATGTGGAAGGG + Intronic
1099305323 12:80947658-80947680 AACCGATCTGGGATTCAGAAAGG + Intronic
1100634505 12:96422521-96422543 TACAAATGTTGGATTCAGAAGGG + Intergenic
1101299884 12:103468327-103468349 GTTACATTTGGAATCCAGAATGG - Intronic
1101510964 12:105391945-105391967 GACAGATGTGGGAATCAGACAGG + Intronic
1105279367 13:18954314-18954336 GACCCATCTGGGACTCAGGAGGG - Intergenic
1106254934 13:28013698-28013720 GACACAATTGGGAGACAGAGTGG + Intronic
1107399606 13:40056457-40056479 TACAAATTCAGGATTCAGAATGG + Intergenic
1107496299 13:40928848-40928870 GAAACCTTTGGCATTTAGAAGGG + Intergenic
1107690389 13:42947768-42947790 GCCACATTTGGGCAACAGAAAGG - Intronic
1107949895 13:45452488-45452510 GACACATTTTGGGTGCAGGAGGG - Intergenic
1108801875 13:54107176-54107198 AACACATTTGTAATTCAGCATGG + Intergenic
1109966545 13:69706064-69706086 GAAACACTAGGGACTCAGAAAGG + Intronic
1111584409 13:90265661-90265683 CAAATATTTGGGATTCAGACTGG - Intergenic
1111599554 13:90454781-90454803 GACACACTTGAGTTTCTGAATGG - Intergenic
1112145643 13:96696801-96696823 GCCTCATTTGGCATTTAGAAGGG + Intronic
1112184578 13:97115410-97115432 GAGAAAGCTGGGATTCAGAAGGG - Intergenic
1114307371 14:21436588-21436610 CACACATTTGGCAGTGAGAATGG - Intronic
1114415961 14:22544533-22544555 GACACAATAGAGATTCAGAGGGG + Intergenic
1114951197 14:27756319-27756341 CACTCATTTTGGATTTAGAAAGG + Intergenic
1115864869 14:37734070-37734092 GAAACATTTGAGACTTAGAATGG + Intronic
1116211512 14:41951874-41951896 GAGATATTTGGGATTGAAAAGGG - Intergenic
1120762396 14:88296981-88297003 GACACATTCTGATTTCAGAAGGG + Intronic
1123476180 15:20593770-20593792 GACAAACTGGGGATTCAGCAGGG - Intergenic
1123641832 15:22406594-22406616 GACAAACTGGGGATTCAGCAGGG + Intergenic
1125536765 15:40445317-40445339 GGCACATTTGACATCCAGAAAGG + Intronic
1126047244 15:44653656-44653678 GAAACATTTAGGAGACAGAAAGG + Intronic
1126474113 15:49047821-49047843 GGAACATTTGGGATTCAAGAGGG - Intergenic
1127387048 15:58475151-58475173 GACACATTTGAGAGACAGACAGG - Intronic
1128681849 15:69658135-69658157 GGCAGATTTGGGTTTTAGAAAGG - Intergenic
1130393251 15:83478266-83478288 CAGAGATTTGGGATTCAGCAAGG + Intronic
1130447812 15:84020252-84020274 GACACACTTGGGATCCAGTCCGG + Intronic
1130913415 15:88286418-88286440 AAAACATGTGGGATTTAGAAGGG + Intergenic
1131770608 15:95733309-95733331 TGCACATTTGGTATTAAGAAGGG + Intergenic
1133611575 16:7438572-7438594 CACAAGTTTGGGATTCAGAGAGG - Intronic
1134028286 16:10971478-10971500 GGCACGTGTGGGATTCAGAGTGG + Intronic
1137769881 16:51007674-51007696 GACAGATTTGGGGGTCAGAGGGG - Intergenic
1138823355 16:60288027-60288049 GACAAATTTGTGAATCAGATGGG - Intergenic
1143357345 17:6340253-6340275 GAAGCATTTGGGATGTAGAATGG - Intergenic
1144604376 17:16651996-16652018 TACACAATAGGGATTCTGAAGGG + Intronic
1146614564 17:34344612-34344634 TAGACATTGGAGATTCAGAAGGG + Intergenic
1147018931 17:37515378-37515400 CAGACATTTGCCATTCAGAAGGG - Exonic
1147491782 17:40875660-40875682 GACACATTTTGCCTTGAGAAGGG + Intergenic
1149090628 17:52774005-52774027 GACACAGTTGTGTTTTAGAAAGG + Intergenic
1150798891 17:68262908-68262930 GACAAAGTTGGGACTAAGAATGG + Intronic
1150899652 17:69257774-69257796 TACACTTTTGAGATCCAGAAAGG + Intronic
1154477386 18:14776213-14776235 CACACAGTTGGTACTCAGAAAGG - Intronic
1156359652 18:36373206-36373228 AACATATTTGTGGTTCAGAATGG + Intronic
1158290435 18:55934617-55934639 AAGATATTCGGGATTCAGAAAGG + Intergenic
1159693533 18:71522954-71522976 GTCATCTTTGGGATTCAGACTGG + Intergenic
1159939592 18:74396691-74396713 GACAAACTTGGGCTTGAGAACGG - Intergenic
1166685694 19:44794782-44794804 GACACATCTGGGATGCTGGAAGG - Intronic
1166848396 19:45744845-45744867 GTCAGATTTGTGTTTCAGAAAGG + Intronic
1167759747 19:51438479-51438501 GAAGCATTTGGGAGTCAAAAAGG - Intergenic
1168535654 19:57167170-57167192 GACATATTTGAGCTTCAGGAAGG - Intronic
925120165 2:1412041-1412063 GACACATTTGGGAGTCCTGAGGG - Intronic
925801884 2:7609735-7609757 GACACATATGGGACACAGGAAGG - Intergenic
926448784 2:12976512-12976534 AATACATTTGGGAATCAGAGAGG - Intergenic
926594465 2:14775290-14775312 TTCTCATTTGAGATTCAGAAAGG + Intergenic
926934333 2:18072210-18072232 GAAAAATTTGGGATTCAAAGAGG + Intronic
927878998 2:26677274-26677296 AATACATTTGGGAATCAGGACGG - Intergenic
928242215 2:29596526-29596548 GAAACAATAGAGATTCAGAATGG + Intronic
928963675 2:36955625-36955647 GGCAGATTTGGAGTTCAGAAAGG - Intronic
931985570 2:67738651-67738673 TACACACTTGTGATTCAGAGAGG + Intergenic
932715188 2:74095565-74095587 TACACATTTGGGTGTCTGAATGG - Intronic
942144657 2:173014793-173014815 TACCCATTAGGGAGTCAGAATGG - Intronic
942213503 2:173695209-173695231 GATACATTTGGGTTTCAGAGGGG - Intergenic
942450077 2:176103811-176103833 GACACATTTGTCTTTCTGAAGGG - Intergenic
942827910 2:180202877-180202899 GAAGCCTTTGGAATTCAGAACGG + Intergenic
944031729 2:195242313-195242335 AACAAATTTTGAATTCAGAATGG + Intergenic
945054842 2:205859498-205859520 GAGACAAGAGGGATTCAGAATGG - Intergenic
946120963 2:217514107-217514129 TCCACATTTGGGATCCAGAATGG + Intronic
946197117 2:218040287-218040309 GACATGGTTGGGACTCAGAAGGG + Intronic
946844272 2:223845346-223845368 GTCTCATTAAGGATTCAGAATGG + Intergenic
947459501 2:230291026-230291048 GAGACATTTCAGGTTCAGAAAGG - Intronic
947560428 2:231144735-231144757 TACAAATTTTGGATTCAGACTGG + Intronic
948709247 2:239815294-239815316 GACAAAGCTGAGATTCAGAAAGG - Intergenic
1169658256 20:7950630-7950652 CACAAGTTTGGGAATCAGAATGG + Intergenic
1170357337 20:15507054-15507076 GACACATTTGGGCTACTCAAAGG - Intronic
1170508249 20:17051097-17051119 GACAGATTTGGAACTCAGAATGG + Intergenic
1171095030 20:22324732-22324754 AGCACATTTATGATTCAGAAAGG + Intergenic
1171501069 20:25593689-25593711 GAAACATTTGGGAGGCAGCAAGG - Intergenic
1171564629 20:26169587-26169609 GACACTTTATGGATGCAGAAAGG + Intergenic
1172778711 20:37423185-37423207 GAGATGTTTGGGGTTCAGAATGG - Intergenic
1173080915 20:39866622-39866644 CACACATTTGGGAATCAAAGAGG + Intergenic
1173170594 20:40720515-40720537 GACACGTTTGTGGTTCAGTACGG - Intergenic
1177095560 21:16827555-16827577 GGCACATTGGGTATTCAGCAGGG - Intergenic
1177556792 21:22701245-22701267 TACACATTGGAGACTCAGAAAGG - Intergenic
1178222345 21:30674719-30674741 AACACACTTGGGCTGCAGAAAGG + Intergenic
1178755712 21:35347485-35347507 TAGACATTGGGGACTCAGAAAGG - Intronic
1182727142 22:32456916-32456938 AACACCTTGGGGCTTCAGAAAGG - Intronic
949641469 3:6040034-6040056 GAAACATGTTGGATTCTGAAAGG + Intergenic
952234875 3:31468739-31468761 GAAACACAGGGGATTCAGAAAGG - Intergenic
953199833 3:40768868-40768890 CAAACCTTTGGGATTAAGAAGGG + Intergenic
953636355 3:44668423-44668445 AACACATTTGGCATTTAGTATGG - Intergenic
954237899 3:49271033-49271055 GACACAACTGGGATTTAAAAAGG + Exonic
954974160 3:54677021-54677043 GTGGCATTTGAGATTCAGAAAGG + Intronic
955260717 3:57387648-57387670 GACTCCCTTGGAATTCAGAATGG + Intronic
956278614 3:67531007-67531029 GAAACAACTGAGATTCAGAAAGG + Intronic
956677530 3:71750282-71750304 GACACATTTGAGATTCCAAGAGG + Intronic
956680006 3:71769996-71770018 GACACTTTTGGTATTCAGTAAGG - Intergenic
956997710 3:74847084-74847106 TTCACACTTGGGATTTAGAAGGG + Intergenic
957799061 3:85051073-85051095 CAGACTTCTGGGATTCAGAATGG + Intronic
959298379 3:104567810-104567832 TACAAATATGGGGTTCAGAAAGG - Intergenic
960025241 3:113001794-113001816 GCTACATTTAAGATTCAGAATGG + Intronic
960311631 3:116123602-116123624 GAAACATTTTTGATTCACAATGG - Intronic
962063647 3:131956346-131956368 GAGATATGTGGGATTCATAAGGG + Intronic
967495466 3:190139587-190139609 GACACAGTTGAGAAACAGAAAGG + Intergenic
969302015 4:6302656-6302678 AACACACTTGGTATTCAGAGTGG - Exonic
969999307 4:11348066-11348088 TACACATTTGTAAATCAGAAGGG - Intergenic
971454259 4:26829339-26829361 AACACATTTCAGATTTAGAAGGG + Intergenic
972092768 4:35308641-35308663 AACACTTTTAGGATTCAAAAAGG - Intergenic
972289339 4:37677073-37677095 GTCATATTTTAGATTCAGAAGGG - Intronic
974825109 4:67118384-67118406 GAGACAATTATGATTCAGAATGG + Intergenic
975715609 4:77202942-77202964 AAGACATTTGGGATTCACGAAGG - Intronic
976338089 4:83913777-83913799 CTCACATTTTGGATTCAGATGGG + Intergenic
976957708 4:90922734-90922756 GACACATTTAGGAATGAGAAGGG + Intronic
977040316 4:92008414-92008436 GACACTTTTAGGATGCAGAAAGG - Intergenic
977732043 4:100365004-100365026 GAGAGATTTGTGACTCAGAATGG + Intergenic
979343936 4:119562718-119562740 TACACATTTGGGTTTGAGAGAGG + Intronic
982449656 4:155537455-155537477 TACACATTGGAGACTCAGAAGGG - Intergenic
986293770 5:6420868-6420890 GACACATTTGTGACACACAAGGG - Intergenic
988606998 5:32687157-32687179 GAGACATTTGGAAAGCAGAAAGG + Intergenic
990702969 5:58495542-58495564 GATACACATAGGATTCAGAAAGG - Exonic
992878546 5:81082134-81082156 GACACATGGGGCATTCAGAGAGG + Intronic
994168724 5:96636333-96636355 GAAAAATTTGGTATTCACAATGG + Intronic
994738021 5:103581363-103581385 ATCAGAATTGGGATTCAGAAAGG - Intergenic
995137603 5:108696726-108696748 GCCTCAGTTGGGATTCGGAATGG - Intergenic
995448300 5:112271569-112271591 GACAGGCTTGGGAATCAGAAAGG - Intronic
996422632 5:123278975-123278997 AACATATTTGGGATTCAGCTAGG + Intergenic
997017926 5:129959047-129959069 TATTCACTTGGGATTCAGAAGGG - Intronic
997857833 5:137389319-137389341 CAAACATTTGGGATCCACAAAGG - Intronic
998782589 5:145674619-145674641 GACACATTTGGAATTTATATTGG - Intronic
999881493 5:155869582-155869604 GACAGACCTGGGGTTCAGAATGG - Intergenic
1000617284 5:163441356-163441378 GAGACATTTGGAAATCAGAATGG + Intronic
1001138071 5:169119068-169119090 GACAGATTTTGGATCCAGACAGG - Intronic
1002549762 5:179978780-179978802 CACAGATTTGGGATGGAGAAGGG + Intronic
1002892836 6:1351578-1351600 GACACATTTGAAATGCTGAATGG + Intergenic
1003359106 6:5406953-5406975 TACACATTTGGCATTTATAAAGG + Intronic
1003408123 6:5839797-5839819 GACACTTGTGGTATTCAGAGTGG - Intergenic
1003470949 6:6431857-6431879 GACACCATTGGGATTTTGAAAGG - Intergenic
1003583034 6:7359719-7359741 CACAAATTTGGGATACAGAGAGG - Intronic
1003704060 6:8504359-8504381 TACTCATCTGGGTTTCAGAATGG - Intergenic
1003713882 6:8623697-8623719 GGCACATTTTAGAGTCAGAAAGG + Intergenic
1004040101 6:11967006-11967028 GACACATTTGCCTTTAAGAAGGG + Intergenic
1005213141 6:23492798-23492820 GACACACTTAGGATAAAGAAAGG - Intergenic
1005702784 6:28419457-28419479 AACACTTTTGTGATTCAGAGTGG - Intergenic
1007232303 6:40356737-40356759 GACAGATTTGGCATCCAGAGTGG - Intergenic
1007789632 6:44301631-44301653 GACACATGTGGGACCCAAAAAGG - Intronic
1008290184 6:49705523-49705545 GGCAGATCTGGGATTCTGAATGG - Intronic
1008857483 6:56107781-56107803 GTCACATTTGGGTTTAATAAAGG - Intronic
1009370245 6:62891195-62891217 GAAACATTTGTAACTCAGAAAGG + Intergenic
1010034585 6:71310001-71310023 GACAGATTTGAGAGTCAGCATGG + Intergenic
1012096127 6:94964508-94964530 GAGACATTTGGGATTTGAAATGG - Intergenic
1014796803 6:125734465-125734487 GACACATTTTGGAAACAGGAGGG - Intergenic
1015349347 6:132198514-132198536 GACACATTTGGGCTTTCTAATGG + Intergenic
1015693070 6:135947492-135947514 AACACATTTGGCATTCTGATCGG - Exonic
1016326713 6:142911249-142911271 AATACAGTTGGGATTCAGAAAGG + Intronic
1016577918 6:145591230-145591252 GACATATTTGGAATACAGGAAGG + Intronic
1020284306 7:6668270-6668292 GAAAAATTTGGGATTAAGATTGG + Intergenic
1021648673 7:22811383-22811405 CAGACATTTGGGGTTCACAAAGG + Intergenic
1021838187 7:24701337-24701359 AACACATTCGGAGTTCAGAATGG - Intronic
1023436495 7:40145860-40145882 GACACAATGGGTATTCAGTAAGG - Intronic
1028668624 7:93375460-93375482 GTCACAGTTGGGAAGCAGAAGGG - Intergenic
1029816364 7:103099894-103099916 GATACATCTGGGATTCAGCCAGG + Exonic
1031007966 7:116496205-116496227 GACACATTTGTGATTTGAAAAGG + Intronic
1031252284 7:119400745-119400767 GATACATTTTTGATTCAGAGAGG - Intergenic
1031381949 7:121097554-121097576 GATCCATTTTTGATTCAGAATGG + Intronic
1031477279 7:122238711-122238733 GACACACTTGGGAAGCACAAGGG + Intergenic
1032259097 7:130320370-130320392 AACACATTTGAGATTCAGGAAGG - Intronic
1032754969 7:134881043-134881065 GAGACATATGCGCTTCAGAAAGG + Intronic
1033837074 7:145328024-145328046 GATACATCTGGGATTCTCAAAGG + Intergenic
1036159042 8:6369527-6369549 GGTACATTTAGGATGCAGAAAGG + Intergenic
1037203966 8:16291643-16291665 AACAGTTTTGGGATTCAGAAAGG - Intronic
1038866240 8:31441421-31441443 GACACAGGTGGTATTCAGAGTGG - Intergenic
1039225867 8:35387581-35387603 TACAGAGTTGAGATTCAGAATGG + Intronic
1039736258 8:40336057-40336079 GACAGAATTTAGATTCAGAAAGG + Intergenic
1041168180 8:55112437-55112459 GTCAGATTGGTGATTCAGAAAGG - Intronic
1041569274 8:59318767-59318789 CACACAGTTGAGAGTCAGAATGG - Intergenic
1042021420 8:64373923-64373945 GACACGCTTGGGAGACAGAATGG + Intergenic
1042391441 8:68240220-68240242 TACACATTGGAGACTCAGAAAGG - Intergenic
1042522634 8:69730179-69730201 CACAGATCTGGGATTCAGAGAGG + Intronic
1044345839 8:91103255-91103277 GAGACATTTAGGATGCAGCAAGG + Intronic
1045356934 8:101397579-101397601 AACACATTTGGGAATAAGATGGG - Intergenic
1045655375 8:104381570-104381592 GACAGTTGTGGGACTCAGAAGGG - Intronic
1046349667 8:112990873-112990895 AACACATTTGGTTTTCAGAAGGG - Intronic
1052093814 9:24361129-24361151 GACACATTTGAGAAGCTGAATGG + Intergenic
1052905424 9:33829364-33829386 GAGACATTGGGTACTCAGAAAGG + Intronic
1053479527 9:38405710-38405732 GATACATTTGGGATTGAACATGG + Intergenic
1058536190 9:105962561-105962583 CACACATTAGGGATGCAGAGAGG + Intergenic
1059573057 9:115460832-115460854 TAGACATTTGGCATCCAGAATGG + Intergenic
1061436750 9:130568096-130568118 GACCCATCTGGAATTCTGAATGG + Intergenic
1061664046 9:132149946-132149968 GACCCATCTGGGTTTCAGGAGGG + Intergenic
1062189763 9:135242034-135242056 CAGACATTGGGGGTTCAGAAGGG - Intergenic
1062558533 9:137128572-137128594 GACACAAAAGGGACTCAGAAAGG + Intergenic
1188546530 X:31313688-31313710 TAGACATTGGAGATTCAGAAGGG - Intronic
1188575311 X:31641748-31641770 CATACATTTGGGAATTAGAATGG + Intronic
1189829072 X:44952225-44952247 GAAAAATCTGGGATTCAGACTGG + Intronic
1190837468 X:54114246-54114268 TACACATTGGGGACTCAGAAGGG + Intronic
1194582368 X:95691477-95691499 GTCACATATGGGAATGAGAAAGG + Intergenic
1195772328 X:108364588-108364610 TAGACATTTGAGACTCAGAAAGG - Intronic
1196431739 X:115634223-115634245 GACAGAACTGGGACTCAGAAAGG + Intronic
1197159725 X:123309717-123309739 GACAGCTTGGGGATCCAGAAGGG + Intronic
1197722066 X:129752005-129752027 GCCAGATTTGGGATTCAATAGGG - Intronic
1199158602 X:144580346-144580368 GATAAATTTGAGACTCAGAAGGG - Intergenic
1199656751 X:150003866-150003888 AAGACATTTGGGAATAAGAAAGG + Intergenic
1201714972 Y:17034370-17034392 GAGATTTTTGGGATTCAGAATGG + Intergenic
1202151396 Y:21847065-21847087 ACCCCAGTTGGGATTCAGAAAGG - Intergenic
1202269086 Y:23053274-23053296 GATACATGTGGGCTGCAGAATGG + Intergenic
1202422078 Y:24687014-24687036 GATACATGTGGGCTGCAGAATGG + Intergenic
1202448708 Y:24983064-24983086 GATACATGTGGGCTGCAGAATGG - Intergenic