ID: 911660394

View in Genome Browser
Species Human (GRCh38)
Location 1:100495309-100495331
Sequence TAGCTTAGATTGCCAGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911660394 Original CRISPR TAGCTTAGATTGCCAGAGAC TGG (reversed) Intronic
906388122 1:45389606-45389628 TTGCTTAGAATACCAGAAACTGG - Intronic
908820771 1:68084240-68084262 TAGCTAACAGTGGCAGAGACTGG + Intergenic
910432923 1:87176581-87176603 TAGGTTAGTTTTCCAGGGACTGG + Intergenic
911446274 1:97996851-97996873 TAGATTAGTTTGTCAGAGATTGG + Intergenic
911660394 1:100495309-100495331 TAGCTTAGATTGCCAGAGACTGG - Intronic
914346974 1:146808302-146808324 TAGATGAGATTGCCTGAGAGAGG + Intergenic
916352322 1:163864789-163864811 TAGCTCAGTTTACCAGAGACTGG - Intergenic
917522158 1:175757087-175757109 TAGCTTAGAATGACAGTGAGAGG - Intergenic
919409874 1:197229215-197229237 TAGCTCAAACTGACAGAGACAGG + Intergenic
1064401077 10:15021510-15021532 TTGCTTAGGTTTCTAGAGACTGG - Intergenic
1064899973 10:20284981-20285003 TAACTTAGATGGCCACAGATGGG - Exonic
1071417265 10:85452992-85453014 TAGAGTAGAATGCCAGAGATGGG - Intergenic
1072729857 10:97838352-97838374 TTGCTTAGCTTGGTAGAGACTGG - Intergenic
1073645477 10:105297404-105297426 GAGATTAGATATCCAGAGACAGG + Intergenic
1074473527 10:113748864-113748886 TTGCGTAGATTGCCAGATATTGG - Intergenic
1076921203 10:133455666-133455688 TAGCTGAGATGCTCAGAGACCGG + Intergenic
1078603623 11:12755795-12755817 TAGGATAGATTGCCTGAAACTGG + Intronic
1084231291 11:67755301-67755323 TAGTTTAGTTTTTCAGAGACAGG + Intergenic
1088148828 11:106718959-106718981 TTGGTTAGATAGCCAAAGACTGG - Intronic
1091816884 12:3445481-3445503 TAGCTAAGAGTGCCAGGCACTGG - Intronic
1099879954 12:88455759-88455781 TAGGATACATTGCCAGAGTCCGG + Intergenic
1100196203 12:92248439-92248461 TAGCTTACACAGCCAGACACAGG - Intergenic
1100274503 12:93059411-93059433 TGGCTGAGATTGAGAGAGACAGG + Intergenic
1100671742 12:96820983-96821005 CAGCTTAGATTGTCTGAGGCAGG + Intronic
1105644780 13:22304890-22304912 TAAGTTAGATTGCCTGATACAGG + Intergenic
1107498337 13:40950624-40950646 TAGCTGAGAATATCAGAGACTGG - Intronic
1112159036 13:96849263-96849285 TAGATTACATTTCCAGAGCCTGG - Intergenic
1112388111 13:98958764-98958786 TATCTTATATGTCCAGAGACAGG - Intronic
1117330636 14:54708507-54708529 TAAATGAAATTGCCAGAGACTGG + Intronic
1117704928 14:58455590-58455612 TAGCTTAGTCTGCCAGTGATTGG + Intronic
1124936982 15:34182819-34182841 TATCAGTGATTGCCAGAGACAGG + Intronic
1127628751 15:60805707-60805729 TTGCTCAGTTTGCCAGAGAGAGG - Intronic
1131945781 15:97618947-97618969 TAGCTTAGAAAGCCAGAAAAAGG + Intergenic
1134687832 16:16171026-16171048 TAGCTTAGGGTGCCAGAGAAAGG - Intronic
1135210175 16:20519161-20519183 TACCTCTGATTCCCAGAGACAGG + Intergenic
1135680556 16:24453211-24453233 GAGCAGAGATTTCCAGAGACGGG + Intergenic
1139531572 16:67545146-67545168 TTGCTCAGATTCCCAGTGACAGG + Intronic
1139987009 16:70906968-70906990 TAGATGAGATTGCCTGAGAGAGG - Intronic
1141040955 16:80671839-80671861 TAGACTAGATTCCCAGAGGCAGG - Intronic
1144600031 17:16603943-16603965 GAACTTATATTACCAGAGACTGG - Intergenic
1150540988 17:66099012-66099034 TGGCTCAGAGTGCCAGAGATGGG + Intronic
1153447725 18:5193195-5193217 AAGCTTAGATGTCAAGAGACTGG + Intronic
1163083033 19:14957075-14957097 AAGCTTAGAAGGCCAGAGACAGG - Intronic
926235578 2:11040982-11041004 TAGATTCGATTGTCAAAGACAGG + Intergenic
926385575 2:12332789-12332811 GAGCTAGGATCGCCAGAGACAGG - Intergenic
926849754 2:17182275-17182297 TGACTAAGATTGCCAGACACTGG - Intergenic
927517115 2:23678528-23678550 TGGCTGATATTGGCAGAGACTGG - Intronic
927517198 2:23679296-23679318 TGGCTGATATTGGCAGAGACTGG + Intronic
932660866 2:73650752-73650774 CAGATTAGGTTGCCAGGGACTGG - Intergenic
939754388 2:146092151-146092173 TAGCTGAGATTGCCGGTGCCTGG - Intergenic
1170590692 20:17769163-17769185 AAGGTAAGATTGCCAGAGAAAGG - Intergenic
1170922944 20:20696398-20696420 TTGGTTAGCTTGCCAGAGATAGG - Intronic
1177407364 21:20687220-20687242 TAGCTCAGACTGCCATAAACTGG - Intergenic
1178624483 21:34203710-34203732 AAGCTTAGATTGGAGGAGACCGG + Intergenic
1178746804 21:35259570-35259592 AAGCTCAGATTACCAGATACAGG - Intronic
1181459346 22:23077127-23077149 TAGATGAGCTTGCCAGTGACTGG + Intronic
1184371935 22:44088140-44088162 GAGCTTAGAATCCCAGAGCCAGG - Intronic
1185217094 22:49607518-49607540 TATCTTAGAATACCACAGACGGG - Intronic
951369624 3:21829437-21829459 TGGCTTAGAGTGGCAGAGACAGG + Intronic
954193496 3:48981612-48981634 TAGCTTAGAATCACAGACACAGG + Intronic
961879910 3:130054272-130054294 TAGTTTAGTTTTTCAGAGACAGG + Intergenic
962044228 3:131738658-131738680 TGGCTTTGATAGCCAGAGACTGG + Intronic
964585632 3:158296773-158296795 TTGCTAAGATTGCCAGAAGCAGG + Intronic
964951489 3:162300478-162300500 AAGCTTAGCTAGCCAGACACAGG + Intergenic
966026795 3:175293781-175293803 TATCTTATATTTCCAGAGCCTGG - Intronic
968119000 3:196111192-196111214 TACATTAGACTGTCAGAGACAGG - Intergenic
970973561 4:22015300-22015322 TAGATGATATTTCCAGAGACTGG - Intergenic
976206138 4:82625247-82625269 TTGCCTACATTGCCTGAGACAGG + Intergenic
977453376 4:97226483-97226505 TAGCTTGGCCTGACAGAGACAGG + Intronic
977855162 4:101881402-101881424 TAGCTTATATTCCAAAAGACAGG + Intronic
984044198 4:174777511-174777533 GATCATTGATTGCCAGAGACTGG + Intronic
986474798 5:8117596-8117618 TAGCTTATTTTGCCACAGAAGGG - Intergenic
989438198 5:41439005-41439027 TTGCTTAGATTGCTAAAGACCGG - Intronic
997414446 5:133714244-133714266 TATTTTACATTGCCAGAGACGGG - Intergenic
1000673515 5:164091854-164091876 TATCTTAGATTCATAGAGACTGG - Intergenic
1003013799 6:2451823-2451845 TAACTCAGATTGCCAGGGTCTGG + Intergenic
1008755253 6:54787551-54787573 TAACTTAAATAGCCAGACACAGG + Intergenic
1009401677 6:63263629-63263651 TAGCTTTGATTGCCTGACCCTGG - Intergenic
1009692472 6:67054125-67054147 TAGCTTAAATTTCTGGAGACTGG + Intergenic
1011112329 6:83852709-83852731 TGGCTAAGAGAGCCAGAGACTGG - Intergenic
1011741523 6:90365295-90365317 TAGTGTACATAGCCAGAGACTGG + Intergenic
1017311033 6:152978036-152978058 TAGCTTAGTTTGCCCAATACAGG + Intronic
1017791832 6:157806765-157806787 TAGTTTAGATTGACATAGAAAGG - Intronic
1018325885 6:162668474-162668496 TAGAAGAGAATGCCAGAGACGGG + Intronic
1022401299 7:30040765-30040787 TAGCTATCATTGCCAGGGACGGG - Intronic
1022750102 7:33215463-33215485 TATCATATATTGCAAGAGACAGG - Intronic
1023889297 7:44381188-44381210 TGGCTGAGATGGCCTGAGACAGG + Exonic
1029857855 7:103536764-103536786 TAGAATAGATGGCCAGAAACAGG - Intronic
1030680235 7:112426473-112426495 TGGCTTATAATTCCAGAGACTGG + Intronic
1032662501 7:134000773-134000795 TGGCTAAAAGTGCCAGAGACAGG - Intronic
1033926170 7:146463211-146463233 TAGAATAGATTATCAGAGACAGG - Intronic
1037043582 8:14269386-14269408 TAGCATAAATTTCCAGAGACAGG + Intronic
1039081925 8:33741979-33742001 TAGCTTAAAAAACCAGAGACAGG + Intergenic
1039242839 8:35575412-35575434 TAGCTTACATTGACAGATAAGGG + Intronic
1041358602 8:57026221-57026243 TTGCATAGCTTTCCAGAGACTGG + Intergenic
1046117841 8:109805446-109805468 TATAATAGAATGCCAGAGACTGG + Intergenic
1050046599 9:1553106-1553128 TAGATTGAATTTCCAGAGACTGG + Intergenic
1051707264 9:19893721-19893743 TAGCTTTGACTGCAAGTGACAGG + Intergenic
1060600924 9:124876803-124876825 GAGCCTGGCTTGCCAGAGACAGG - Intronic
1062505949 9:136876659-136876681 TAGCAAGGATTGCCAGACACAGG - Intronic
1186584713 X:10860460-10860482 TTGCTTAGTTTCCAAGAGACAGG + Intergenic
1188244543 X:27824133-27824155 TATAATAGAATGCCAGAGACTGG + Intergenic
1191229307 X:58081506-58081528 TTGCTTAGAATGCCAGAGTTCGG - Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1195176210 X:102317699-102317721 TAGCTTAGATTTCTAAAGAAAGG - Intronic
1195182654 X:102369394-102369416 TAGCTTAGATTTCTAAAGAAAGG + Intronic
1195747192 X:108130670-108130692 TAGATTAGATAACTAGAGACTGG + Intronic
1197236768 X:124075086-124075108 TATCAAAGATTACCAGAGACAGG + Intronic
1201406431 Y:13654562-13654584 TAGCTTGCATTTCAAGAGACAGG + Intergenic