ID: 911661174

View in Genome Browser
Species Human (GRCh38)
Location 1:100503043-100503065
Sequence TTTCTAAGCAAAGTTAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911661174_911661178 -8 Left 911661174 1:100503043-100503065 CCCCCTTTAACTTTGCTTAGAAA 0: 1
1: 0
2: 2
3: 23
4: 256
Right 911661178 1:100503058-100503080 CTTAGAAAACCTCCTGTGAGAGG 0: 1
1: 0
2: 2
3: 17
4: 185
911661174_911661183 26 Left 911661174 1:100503043-100503065 CCCCCTTTAACTTTGCTTAGAAA 0: 1
1: 0
2: 2
3: 23
4: 256
Right 911661183 1:100503092-100503114 GTCCTACTTCTGCTGACTTGTGG 0: 1
1: 0
2: 0
3: 7
4: 121
911661174_911661179 -7 Left 911661174 1:100503043-100503065 CCCCCTTTAACTTTGCTTAGAAA 0: 1
1: 0
2: 2
3: 23
4: 256
Right 911661179 1:100503059-100503081 TTAGAAAACCTCCTGTGAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911661174 Original CRISPR TTTCTAAGCAAAGTTAAAGG GGG (reversed) Intronic
901281738 1:8042216-8042238 TATCTAATCAAAGTTATAGCAGG - Intergenic
901708225 1:11092945-11092967 TTTCTGAGCACATTTAAAGCAGG + Intronic
903063438 1:20685415-20685437 TTTCTTAGCAATGGAAAAGGAGG - Intronic
904065971 1:27751401-27751423 TTTCAAAGCAAAGTAAATGCAGG - Intronic
905117056 1:35651264-35651286 TTTCTAAGAAAACTTACAAGAGG - Intergenic
905591041 1:39163808-39163830 TTTCCAAGCCAAGTTGAAGAGGG - Intronic
905655379 1:39683348-39683370 TTTCTCTGCAGAGTTCAAGGAGG - Intronic
909928588 1:81468539-81468561 TTTAAAAGCAAAGCTAAAGAAGG + Intronic
910507894 1:87970989-87971011 TTTATAAGCAAAGTCCAAAGGGG - Intergenic
911496067 1:98632888-98632910 TTTTTAAGAAAAATTAAAAGTGG + Intergenic
911661174 1:100503043-100503065 TTTCTAAGCAAAGTTAAAGGGGG - Intronic
912198097 1:107423611-107423633 TGTATAAGCAAAGCTAAAGGGGG - Intronic
912466115 1:109875483-109875505 TTTACAAGTTAAGTTAAAGGAGG - Intergenic
914952621 1:152130321-152130343 TTTATGAGCAAAGGTAAAGAAGG + Intergenic
916313698 1:163424473-163424495 TTTTTAAGCAAACCTAAAAGAGG + Intergenic
916765436 1:167855625-167855647 TCACTAAGCAAAGTTTAAGAAGG + Intronic
916998587 1:170329517-170329539 CTCCTAAGAAAAATTAAAGGAGG - Intergenic
918436924 1:184524400-184524422 TATCTAAGTAAGGTTTAAGGAGG - Intronic
918558067 1:185829287-185829309 TTTCTAAAAAAAATAAAAGGGGG + Intronic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
921757476 1:218875851-218875873 TTTCTTAGCAAGGCAAAAGGAGG + Intergenic
922230579 1:223682089-223682111 TTTCAAAGGAAAGGCAAAGGAGG + Intergenic
922690884 1:227689488-227689510 TTTCTCAGCAAAATAAAAGGTGG + Intergenic
923069830 1:230552518-230552540 TTCCTAAAAAAAGTTAAAGATGG + Intergenic
924391395 1:243563358-243563380 TTTCTAAGGAAAGTCCAAGATGG + Intronic
1063269768 10:4494942-4494964 TTTATAAGTAAAGTTAATGACGG + Intergenic
1064778765 10:18809773-18809795 TTTCTAGGCAATGTTAGAGCAGG - Intergenic
1065145577 10:22764469-22764491 TTTGGAAGCAAACTTGAAGGAGG + Intergenic
1067228057 10:44388068-44388090 TTGTTAAGCACAGTTCAAGGTGG + Intergenic
1069232387 10:66027796-66027818 TTTTTGAGCCAAGATAAAGGAGG - Intronic
1069393474 10:67962712-67962734 TTTAAAAGCAAAGTTAAAGGAGG + Intronic
1070592342 10:77810072-77810094 TTCCTAAGGAAAGGTAAAGTTGG + Intronic
1072168452 10:92837294-92837316 TTTCTAATAAAAGTGAAAAGAGG + Intronic
1072254847 10:93611425-93611447 TTTTGAAGCAAACTTAAATGTGG + Intergenic
1073534586 10:104264756-104264778 TTTCTGAGCACATTTAAAGCAGG - Intronic
1075024428 10:118974068-118974090 TTTTCAAGGAAAGTTAGAGGGGG + Intergenic
1075912462 10:126136642-126136664 TTTCTTAGCAAAGTCAAGGTGGG - Intronic
1076150734 10:128160101-128160123 TTTCAAAGGAAAGGGAAAGGAGG - Intergenic
1079321154 11:19452634-19452656 GTTCTAAGCACATTTAAAGTAGG - Intronic
1079798131 11:24833357-24833379 TTTCTCAGCAAAATTAATAGTGG - Intronic
1080026891 11:27624530-27624552 TTTTCAAGCAAAATTAAATGAGG - Intergenic
1080830313 11:35887942-35887964 TTTCTAAGCTTTGTTAAAGTAGG + Intergenic
1081709405 11:45207302-45207324 TTTCTTAACAAAATTAATGGTGG + Intronic
1083063762 11:59901569-59901591 TTTCTAGGCAAAGATAAAAGAGG + Intergenic
1083907127 11:65680192-65680214 TTTCCAAGGAAACTTAATGGGGG + Intergenic
1084144368 11:67256278-67256300 GTTCAATGCAAAGTAAAAGGGGG - Exonic
1086193358 11:84107484-84107506 TTTATAAGGAAAATTAAAGATGG - Intronic
1088104451 11:106190301-106190323 TTTTTAAACAAAATTATAGGAGG + Intergenic
1088384419 11:109237414-109237436 TTGCTAAGCAGTGTTCAAGGTGG + Intergenic
1089269579 11:117292472-117292494 GTACTAAGAAAAGTTAAAAGCGG - Intronic
1089925204 11:122249752-122249774 TTTCTTGGCAAAGCTAAAGGGGG - Intergenic
1094690575 12:32764450-32764472 TCTCCAAGCACAGTTTAAGGAGG + Intergenic
1095280113 12:40341235-40341257 TTTGTAAGTAAAATTACAGGTGG + Intronic
1095458639 12:42417585-42417607 TTTCTACGCTTACTTAAAGGAGG - Intronic
1097017295 12:55996654-55996676 TTTCTACGCAAAATAAAAGACGG + Exonic
1098004806 12:65984890-65984912 TTTTAAAGCAAAATTACAGGAGG - Intergenic
1098196278 12:68005154-68005176 TTCCTCAGAAAAATTAAAGGGGG + Intergenic
1098535114 12:71585238-71585260 TTTCTGAGGAAAGGCAAAGGAGG - Exonic
1099080160 12:78168575-78168597 TTTCTCAGCTAAAGTAAAGGAGG - Intronic
1100447139 12:94671243-94671265 TCTCTATGCAAAATTAAAGTAGG - Intergenic
1100858117 12:98776378-98776400 TTTCTAAGCACATTTTAAGAAGG + Intronic
1101160858 12:101974257-101974279 TTTCTAAGCAAAGTTGCTGGAGG - Intronic
1105319450 13:19304417-19304439 TTTCTAACAAAATTTAATGGGGG + Intergenic
1106468222 13:30031782-30031804 CTTCCAAGGAAAGATAAAGGCGG + Intergenic
1107139358 13:36980525-36980547 TTTCTAAGCAAAGTATATGCTGG - Intronic
1108677994 13:52754392-52754414 TTCCTAAACAAAGTGAAAGTAGG - Intergenic
1108808506 13:54189552-54189574 ATTGTAGGCAATGTTAAAGGGGG - Intergenic
1108970932 13:56375635-56375657 TTTCTAATCAAACTAAAAGAGGG + Intergenic
1109131791 13:58596148-58596170 TTTCTCTGCAAAGTTCAATGAGG - Intergenic
1111529918 13:89523216-89523238 TTTCTAAGCTAAGTTTTAAGTGG - Intergenic
1114824970 14:26066034-26066056 TTTATAAGCAAAGAGAAAAGAGG + Intergenic
1115823672 14:37239779-37239801 TTTCTCAGAAAAATTAATGGAGG + Intronic
1116169628 14:41383528-41383550 TTTATATTCAAAGATAAAGGAGG - Intergenic
1117029623 14:51654343-51654365 TTTATAAGTATAGTTAAATGTGG - Intronic
1119461904 14:74812490-74812512 TCTCTAATTAAAGTTAAAAGTGG + Intronic
1120221144 14:81735178-81735200 TGTCTAAAGAAAGTTAAAGGAGG - Intergenic
1120649903 14:87119467-87119489 TTTTTAAACAAAGTTATGGGAGG + Intergenic
1122533940 14:102448963-102448985 TTTAAAAGCAAAATTAAAGCTGG + Intronic
1202910291 14_GL000194v1_random:110436-110458 TTTTTAAGCAAAATTATGGGAGG + Intergenic
1202882285 14_KI270722v1_random:72060-72082 TTTTTAAGCAAAATTATGGGAGG - Intergenic
1127277790 15:57462354-57462376 TTTCTCAGCACAGTTACAAGAGG + Intronic
1130873458 15:87991373-87991395 TTTCTATGCAGAGTAAAATGTGG + Intronic
1130988360 15:88859433-88859455 TACCTAAGCACATTTAAAGGGGG - Intronic
1131434240 15:92410595-92410617 TTTTCAAGCATAGTTAAATGTGG + Intronic
1134646491 16:15871997-15872019 TTTTTAAGGACAGTTAAAGGTGG - Intronic
1135255031 16:20934434-20934456 GTTCTAAGCACATTTAAGGGAGG - Intronic
1135607859 16:23838255-23838277 TTTCTCAGCAAAGTTAAAGTTGG - Intronic
1139656769 16:68392500-68392522 TTTGTAATCAAGTTTAAAGGTGG + Intronic
1144315569 17:14057683-14057705 TTTCTAAGGAAAGTTGCAGTGGG - Intergenic
1144342821 17:14324306-14324328 TTTTTAAGCAAAGTTGATGGAGG - Intronic
1152969183 18:144698-144720 TTCTTAAGCAAAGAAAAAGGGGG + Intergenic
1153343138 18:3996989-3997011 TTTCTAATCCAATTTAATGGTGG - Intronic
1153505411 18:5791510-5791532 TTTCTAATTAAAGTTAAAAGAGG - Intergenic
1153674272 18:7442391-7442413 TTTCTAAGCTACCTTTAAGGTGG - Intergenic
1154358114 18:13637915-13637937 TTGTTATGCACAGTTAAAGGGGG - Intronic
1156640731 18:39093978-39094000 CTGATAAGCAAACTTAAAGGAGG - Intergenic
1157301684 18:46484066-46484088 TGTCTTAGCAAAGTCATAGGTGG + Intronic
1158030978 18:52964664-52964686 ATTCTAAGCAAATTTTAAGTAGG - Intronic
1158817073 18:61114396-61114418 TTTCTAGGCATAGGTAAAGCAGG + Intergenic
1159147822 18:64477717-64477739 TTTGTAAGCAAAGTGCAATGGGG - Intergenic
1159568808 18:70088354-70088376 TTTCAAAGCAAAGTAAAACTGGG + Intronic
1159711815 18:71769551-71769573 TTTCTTACCAAAGATAAAGAGGG + Intronic
1160299216 18:77664872-77664894 TATCTCAACAAAGTGAAAGGAGG + Intergenic
1164677286 19:30109943-30109965 TTTCAAAGGAAGGTTAAAGGAGG + Intergenic
1164769020 19:30793731-30793753 TTTCTAGTCAAACTTATAGGGGG + Intergenic
1168599508 19:57706697-57706719 TTTCTAAACAGAGGTAAGGGAGG - Intronic
1202657896 1_KI270708v1_random:41158-41180 TTTTTAAGCAAAATTATGGGAGG - Intergenic
925213015 2:2066936-2066958 TTATTAAGAAATGTTAAAGGAGG + Intronic
925757978 2:7152330-7152352 TCTCTAAGCAATATTCAAGGAGG - Intergenic
925793889 2:7522141-7522163 TTTCTAAGGAAAGGAACAGGAGG - Intergenic
928603302 2:32921850-32921872 ATTTTGAGGAAAGTTAAAGGAGG + Intergenic
929643831 2:43607953-43607975 TTTCTAAGCAAATTTTACTGGGG - Intergenic
929872595 2:45771616-45771638 GTTCTAAGAAAAGACAAAGGGGG - Intronic
931274085 2:60728799-60728821 TTTCTGAGAAAACTTACAGGAGG - Intergenic
932971266 2:76545822-76545844 TTTATAAGCAAAGAGTAAGGTGG + Intergenic
933249222 2:80010014-80010036 ATTCTAAGAAAAGTTATTGGAGG - Intronic
933395417 2:81724982-81725004 TTTCTCCTCAAAATTAAAGGAGG + Intergenic
934633107 2:95952140-95952162 TTTTTAAACAAAGGGAAAGGAGG + Intronic
934800396 2:97151129-97151151 TTTTTAAACAAAGGGAAAGGAGG - Intronic
934850535 2:97697589-97697611 TTTCTAAGCCAAGTTGAATAAGG + Intergenic
944475788 2:200104275-200104297 TTTCTAAGTAAAGGGAAAGTAGG - Intergenic
945142126 2:206698308-206698330 TTTCTCAGCAAAATTAAAACCGG + Intronic
945717308 2:213374703-213374725 TTTATAAACAGAGTTAAAGATGG - Intronic
946084016 2:217152852-217152874 TTTCCAAGCAAAGATATAAGTGG + Intergenic
946157548 2:217816964-217816986 TTTCTAAGTAGAGGCAAAGGTGG + Intronic
948171881 2:235910355-235910377 TTTCTAATCAAAGTTAAAACTGG + Intronic
948232741 2:236363828-236363850 TTTCCCAGCAATGTTAGAGGAGG + Exonic
1169721821 20:8686206-8686228 TTTCTCATCCAAGTTCAAGGAGG + Intronic
1175555322 20:59849818-59849840 TTTCTAAAAAAATTTAAAGGGGG + Intergenic
1176597784 21:8763497-8763519 TTTTTAAGCAAAATTATGGGAGG - Intergenic
1176629648 21:9125137-9125159 TTTTTAAGCAAAATTATGGGAGG + Intergenic
1176967746 21:15230347-15230369 TTTCTTAGCAAAGGTAAGTGTGG + Intergenic
1178063238 21:28874873-28874895 CTTCTAAGCAAAGTCAACAGGGG + Exonic
1180369308 22:11969714-11969736 TTTTTAAGCAAAATTATGGGAGG + Intergenic
1180420656 22:12811299-12811321 TTTTTAAGCAAAATTATGGGAGG + Intergenic
1183884811 22:40870716-40870738 TTTTTAAGAAAAATTAAAAGGGG + Intronic
1185096844 22:48812871-48812893 TTTAGAAGCATAGATAAAGGGGG - Intronic
949291743 3:2474131-2474153 TATCTAAACAAAGTTAAGGCAGG - Intronic
949821271 3:8118251-8118273 TTTCTAAGCAATGTAAAAAATGG + Intergenic
951899464 3:27642567-27642589 TTGCTGAGCAAAGTCAGAGGTGG - Intergenic
952576320 3:34778182-34778204 TTTCTAACGAAAGTTAAATTAGG + Intergenic
953106845 3:39889705-39889727 ATTATAAGCAAAGTCAAATGAGG - Intronic
954141389 3:48608505-48608527 TTACTAAGCATAGGAAAAGGTGG - Intronic
954860443 3:53684249-53684271 ACTCTAAGAAATGTTAAAGGAGG + Intronic
955889588 3:63635793-63635815 TCTCTAATCAAAGGTACAGGAGG + Intergenic
956294059 3:67692958-67692980 TTTCTAAGAAAGGTACAAGGGGG + Intergenic
956971008 3:74525360-74525382 TTTTTAATCAATGTTAAAGTAGG + Intergenic
957265776 3:77963485-77963507 TTTGTAAACAAAATCAAAGGGGG - Intergenic
957750922 3:84414205-84414227 TTTGTAAACAAAATTATAGGAGG + Intergenic
958092676 3:88896184-88896206 TTTCTCAGCAATGTAAAGGGGGG + Intergenic
959837545 3:110938003-110938025 TGTCTAGGCAAAGTAAAAGGGGG + Intergenic
960353080 3:116617443-116617465 TTTCCAAGCAAAGGTAGAGGAGG - Intronic
960554506 3:119012664-119012686 TTTCAAAGCAAAAATAAAAGTGG - Intronic
962017952 3:131462551-131462573 TTTCTAACAAAATTTAATGGGGG + Exonic
963979237 3:151517687-151517709 TTTTTAAACAAAGTTATGGGAGG + Intergenic
964080915 3:152755741-152755763 TTTCTTAGCAAGGAAAAAGGAGG - Intergenic
964493445 3:157262108-157262130 TTTCATTGCAAAGTGAAAGGAGG - Intronic
967119042 3:186366282-186366304 TTTCTAAGAAAACTAAAATGAGG - Intergenic
969909833 4:10433673-10433695 TTTCTAAGCACAGTTAGGGTGGG + Intergenic
971424955 4:26507053-26507075 TTTGTAGGCAATGTTACAGGGGG - Intergenic
972350806 4:38234648-38234670 TTCCTAAGAAGAGCTAAAGGAGG - Intergenic
973210403 4:47608966-47608988 ATTCTAAGCAAAGTCAGAGAGGG - Intronic
973361085 4:49165751-49165773 TTTTTAAGCAAAATTATGGGAGG - Intergenic
973891552 4:55372442-55372464 TTTCTAGGCAAAGATAAGAGAGG + Exonic
974576772 4:63735288-63735310 TTTCTAAGTAAAGTTTATGCCGG - Intergenic
975182756 4:71365864-71365886 TGTCTAAGCATAGTAAATGGAGG + Intronic
976388587 4:84486091-84486113 TTTCAAAGGAAAGGTAAAAGGGG + Intergenic
976479766 4:85527132-85527154 ATTCTAGGCAAAGTTGAAGAAGG + Intronic
977419012 4:96773917-96773939 TTTCTCAGCTAACTTCAAGGTGG - Intergenic
978103601 4:104873953-104873975 TTTCTAAGCAGAGTAAATGACGG - Intergenic
978337647 4:107686999-107687021 TATCTAAGCAAAGTGAAACTGGG + Intronic
978536534 4:109769204-109769226 TTTCTATCCAAAGATCAAGGAGG - Intronic
978711302 4:111785433-111785455 TTTGGAAGCAAAGTTAAAACAGG + Intergenic
978920673 4:114179367-114179389 ATTCTAACCAAAGTAAAAGATGG + Intergenic
979460153 4:120973249-120973271 TTTGTAAGCAAGGTTACAGGAGG - Intergenic
980525423 4:133985461-133985483 TTTCTAAGCAAAGATATATTTGG - Intergenic
981118486 4:141020360-141020382 ATTCTAAGGTAAGGTAAAGGTGG + Intronic
981321038 4:143391566-143391588 TTTCAAAGCACAGAAAAAGGCGG + Intronic
981442274 4:144796881-144796903 CTTTTAAGCAAACTTAATGGGGG + Intergenic
981644007 4:146977677-146977699 TTTCTTGGCAAAGTCACAGGTGG + Intergenic
981962862 4:150562783-150562805 TTTCAAAGCAAACTTAATTGTGG - Intronic
982377170 4:154705846-154705868 TTTCTAATTGGAGTTAAAGGAGG - Intronic
982509924 4:156269124-156269146 ATTTAAAGCAAAGTTAAAGAAGG + Intergenic
982659222 4:158187163-158187185 TTTCTGAGCATATTTAAAGTAGG + Intergenic
983281460 4:165686066-165686088 TTTAGAAGAAAAGTTAAAGTCGG + Intergenic
984140927 4:176002574-176002596 TCTCTAATGAAAGTGAAAGGGGG - Intronic
984395383 4:179191367-179191389 TTTCTGAGCACATTTAAAGTAGG + Intergenic
984624780 4:181994986-181995008 TTTCTAAGAAAAGTAGAATGAGG + Intergenic
985436766 4:189938014-189938036 TTTCAAATGAAAGTTTAAGGTGG - Intergenic
986258001 5:6117229-6117251 TTTCAAAGCTAAGTAAAGGGAGG - Intergenic
986409782 5:7465789-7465811 ATTCTAAGCTAAGAGAAAGGAGG - Intronic
987210577 5:15677928-15677950 TTTCTTAGGAAGGTGAAAGGTGG - Intronic
988280481 5:29139620-29139642 TTTCTAAGAAAAGACAGAGGTGG - Intergenic
988817441 5:34848352-34848374 TTTATTAGCAAGGTTAAAGATGG - Intronic
989093505 5:37759037-37759059 TTTTTAAACAAAGTTATGGGAGG - Intergenic
993600726 5:89921300-89921322 TTCCTAAGCACAGGTAAAGGAGG - Intergenic
993740695 5:91535024-91535046 TTTTGAACAAAAGTTAAAGGTGG - Intergenic
993770653 5:91921454-91921476 GCTCTAAGCAAAGTCAAATGAGG - Intergenic
995318061 5:110798612-110798634 TTTCTAAGCAAAAACAAAGATGG - Intergenic
996877658 5:128257508-128257530 TTTTTAAGCAAAGGTAATAGCGG - Intergenic
997764387 5:136485602-136485624 TTTCTATCAAAATTTAAAGGAGG + Intergenic
997910381 5:137866155-137866177 ATTCTAAGCAATTTTAAATGTGG - Intergenic
999803319 5:155058042-155058064 ATCCTAACCAAAGTGAAAGGTGG - Intergenic
1000952750 5:167504231-167504253 TTTCTAACTAAAGTGAAACGTGG + Intronic
1001824927 5:174736724-174736746 CTTCTAAACAAAGATGAAGGGGG + Intergenic
1003201791 6:3968040-3968062 TTTTTAAACAAAGTTAAGGGAGG + Intergenic
1003275612 6:4648004-4648026 TTTATAAGCAGAGTTAAAAAGGG - Intergenic
1003285558 6:4730939-4730961 TTTCCAAAAAAAGTTAAAAGTGG + Intronic
1006712944 6:36091201-36091223 TTTCTAGGGAAAGTAAAAGAGGG - Intronic
1008525198 6:52400628-52400650 TTCCTGAGAAAAGATAAAGGCGG - Intronic
1008544704 6:52574841-52574863 TTTCTGAGCAAAGATAAAACAGG + Intronic
1009584912 6:65587915-65587937 TTTATTATCAAAGTTAAAGATGG + Intronic
1009854958 6:69250351-69250373 TTTCTAAACAAAGAAATAGGTGG - Intronic
1010372551 6:75128256-75128278 TTTCAAAGCAAAAATAAAAGGGG + Intronic
1010738836 6:79474878-79474900 TTTCTAATCAAACTCAAAGATGG + Intergenic
1010816824 6:80367885-80367907 TTTGTAAGCAAAGTTGGATGGGG - Intergenic
1011315614 6:86027514-86027536 TTTCAAAGGAAAGTTAATTGGGG - Intergenic
1011910536 6:92431693-92431715 TTCATCAGCAAAATTAAAGGGGG + Intergenic
1012661864 6:101908415-101908437 TATCTAAGCTAACTTGAAGGAGG + Intronic
1012987323 6:105888413-105888435 TTGCTAAGCAAGGGTAAAGCAGG + Intergenic
1013254102 6:108366978-108367000 CTTCTGAGCAAAGACAAAGGAGG - Intronic
1014421863 6:121256381-121256403 TGTCTGAGAAAAGTTAGAGGAGG - Intronic
1014533765 6:122592585-122592607 TTTATAGGCAAAGTTTCAGGTGG - Intronic
1014822751 6:126010797-126010819 TTGCTAATGAAAGTTAAAGTGGG - Intronic
1015624132 6:135162398-135162420 TTTCTAAGCAAGCTTATAGAAGG - Intergenic
1015720871 6:136240226-136240248 TTTCTAAGCAAAGCTTAAGATGG + Intronic
1015847175 6:137532748-137532770 TCTCCAAGCAAACATAAAGGTGG + Intergenic
1016170424 6:141007682-141007704 TTTCTTAGGAAAGTTACATGGGG + Intergenic
1016946985 6:149544610-149544632 TTTCTAAGCAGAGTTACCTGAGG - Intronic
1019063762 6:169277759-169277781 TTTTTAAGCAAAATTATGGGAGG + Intergenic
1022157230 7:27672647-27672669 TTTCTAACAAGTGTTAAAGGAGG + Intergenic
1022175682 7:27869816-27869838 TTTCTGTGCAAAGTAAAGGGAGG + Intronic
1022342662 7:29483370-29483392 TGTCTAAGCAAAGTAAAATTCGG + Intronic
1022569993 7:31442996-31443018 TTTCTTAGCAAGGTCAAAGAGGG + Intergenic
1028225219 7:88243136-88243158 TTTATAAGAAAAGAAAAAGGAGG + Intergenic
1030652438 7:112130042-112130064 TTTCCAGGCAGAGTTAAAAGTGG - Intronic
1030921192 7:115390539-115390561 CTTCTAAGAAAAGTTGAAGGAGG - Intergenic
1031349601 7:120713573-120713595 TTTCTTAGCAAAATTCAAGCAGG + Intronic
1031849448 7:126846438-126846460 TGTCTAAGCAACATTATAGGAGG + Intronic
1033766571 7:144499225-144499247 TTTCTAAGCAAGTTTAAAAATGG + Intronic
1033849942 7:145482771-145482793 TTTTTAAGCAAAATTATAGGAGG - Intergenic
1034134728 7:148756239-148756261 TTTTTAAGTAAATTTAAAGAAGG + Intronic
1035346515 7:158203444-158203466 CTTCTAAACAACGTTAAATGTGG - Intronic
1037842196 8:22252872-22252894 TTTCCAACCAAAGTTACTGGTGG - Exonic
1046032225 8:108796944-108796966 TTTCCATGGAAAGTTAAGGGAGG - Intergenic
1047162804 8:122399864-122399886 TCTCTAAGGAAAGTTAAAAAGGG + Intergenic
1047515868 8:125554484-125554506 TTTCTAAGCAGAGAGAAAGAGGG + Intergenic
1048283688 8:133124329-133124351 ATTCAAAGAAAAGTTAAATGTGG - Intronic
1048662101 8:136616488-136616510 TTGCTAAGAAAAGCTAAAAGAGG - Intergenic
1048732732 8:137461705-137461727 TTCCTAAGCCAAGTTAAAAATGG + Intergenic
1049954252 9:677406-677428 TTGCTAAACAAAGAGAAAGGAGG + Intronic
1051205704 9:14686613-14686635 TTTTTAAGCTAATTTAAAGTGGG + Intronic
1053724891 9:40989491-40989513 TTTCAAATGAAAGTTTAAGGTGG - Intergenic
1054341077 9:63862510-63862532 TTTCAAATGAAAGTTTAAGGTGG + Intergenic
1055013429 9:71591543-71591565 TTTATAAGCACAGTTATTGGGGG + Intergenic
1059879202 9:118671281-118671303 TTTGAAAACAAAGATAAAGGAGG + Intergenic
1060418163 9:123447607-123447629 TTGCTATGCAGAGTTAGAGGAGG + Intronic
1203690124 Un_GL000214v1:34842-34864 TTTTTAAGCAAAATTATGGGAGG - Intergenic
1203752482 Un_GL000218v1:92818-92840 TTTTTAAGCAAAATTATGGGAGG + Intergenic
1203449924 Un_GL000219v1:102499-102521 TTTCAAATGAAAGTTTAAGGTGG + Intergenic
1203555507 Un_KI270743v1:203823-203845 TTTTTAAGCAAAATTATGGGAGG + Intergenic
1203646151 Un_KI270751v1:69211-69233 TTTTTAAGCAAAATTATGGGAGG + Intergenic
1186566309 X:10666630-10666652 GTTCTGAGCACAATTAAAGGGGG + Intronic
1188214025 X:27456284-27456306 TTTGTAAGGAAAGATGAAGGAGG - Intergenic
1189768189 X:44393610-44393632 TTTCAAATCAATTTTAAAGGAGG - Intergenic
1190724351 X:53178259-53178281 TTTCAAAGCAAAGTTAAATTGGG + Intergenic
1191934910 X:66416987-66417009 TTTCTAAGAAAGGATAAGGGTGG - Intergenic
1191949026 X:66568372-66568394 TATCTGATCAAAGTTAAAAGTGG + Intergenic
1192337445 X:70234210-70234232 TTTATAATTAAAGTTAAAGGTGG + Intergenic
1192915202 X:75644554-75644576 TTTCTTAGCGAGGTTTAAGGGGG + Intergenic
1193313559 X:80037850-80037872 TTTATAAACAAAATTATAGGAGG - Intergenic
1194073180 X:89352894-89352916 TTGCTAAGCAAAGGTAAACTAGG + Intergenic
1194138053 X:90172772-90172794 TTTTTAAACAAAATTATAGGAGG - Intergenic
1198012353 X:132570964-132570986 TTTCCAAACAAATATAAAGGAGG - Intergenic
1198498572 X:137219422-137219444 TTTTTAAACAAAATTATAGGAGG + Intergenic
1198630411 X:138630872-138630894 GTTCTAAGCACATTTAAAGTAGG - Intergenic
1199275806 X:145940500-145940522 ATTCTAAGCAAAGATAAAGCTGG - Intergenic
1200483846 Y:3743026-3743048 TTTTTAAACAAAATTATAGGAGG - Intergenic
1200727412 Y:6688699-6688721 TTGCTAAGCAAAGGTAAACTAGG + Intergenic
1200728564 Y:6704474-6704496 TTGCTAAGCAAAGGTAAACTAGG + Intergenic
1201166131 Y:11210430-11210452 TTTTTAAGCAAAATTATGGGAGG + Intergenic
1201500108 Y:14632788-14632810 TTTTTAAGCACAGTTAAACTGGG + Intronic