ID: 911664235

View in Genome Browser
Species Human (GRCh38)
Location 1:100535900-100535922
Sequence GGCAACACAAAGTGGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911664230_911664235 6 Left 911664230 1:100535871-100535893 CCCTCAGCAGGAATGCTGCTCGT 0: 1
1: 0
2: 1
3: 8
4: 113
Right 911664235 1:100535900-100535922 GGCAACACAAAGTGGCAGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 178
911664231_911664235 5 Left 911664231 1:100535872-100535894 CCTCAGCAGGAATGCTGCTCGTC 0: 1
1: 0
2: 0
3: 10
4: 115
Right 911664235 1:100535900-100535922 GGCAACACAAAGTGGCAGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 178
911664228_911664235 20 Left 911664228 1:100535857-100535879 CCAGGCACTGGAGTCCCTCAGCA 0: 1
1: 0
2: 1
3: 23
4: 227
Right 911664235 1:100535900-100535922 GGCAACACAAAGTGGCAGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911664235 Original CRISPR GGCAACACAAAGTGGCAGCT GGG Intergenic
905261725 1:36723758-36723780 GGTCACATAAAGTGGCTGCTTGG - Intergenic
905904804 1:41610904-41610926 GGGAGCACAGAGTGGGAGCTTGG - Intronic
906267928 1:44448496-44448518 GGCATCAGAAAGTTGCAGCTTGG - Intronic
911664235 1:100535900-100535922 GGCAACACAAAGTGGCAGCTGGG + Intergenic
911704090 1:100990603-100990625 GCCAACACAAAGTGTCTCCTCGG + Exonic
912125440 1:106531843-106531865 GGTAACTAAAAGTGGCAGCAAGG - Intergenic
919343492 1:196344712-196344734 GGGAACACAATGTGGTAACTTGG + Intronic
922019681 1:221691093-221691115 GGCAGCACAAAGTGATAGCATGG - Intergenic
1063384707 10:5608823-5608845 GGGAAGACGAATTGGCAGCTGGG + Intergenic
1063553290 10:7053576-7053598 GGTAACACAAAGAGGAAGCAGGG + Intergenic
1064128284 10:12684118-12684140 AGCAGCACAAACTGGCCGCTGGG - Intronic
1066667662 10:37801731-37801753 GACAACACCAAGTGTCAGCAAGG + Intronic
1068675336 10:59764179-59764201 GGCAACACAGAGAGCCAGGTGGG + Intergenic
1068878256 10:62020902-62020924 GGCTACAGCAAATGGCAGCTTGG - Intronic
1071814768 10:89221071-89221093 GGTATCACAAAGGGGCAGCAGGG + Intronic
1072791517 10:98321477-98321499 GGCAACACCAAGTGTCTGCCAGG - Intergenic
1073045643 10:100636518-100636540 GGCAGCACAGAGTGGTGGCTAGG + Intergenic
1075959732 10:126558108-126558130 GGCAAGACAAAGAGAAAGCTGGG - Intronic
1077084763 11:743765-743787 GGCAACACCAAGTGCCAGTGAGG - Intergenic
1078357928 11:10646752-10646774 TGAAACACAAAGTGGATGCTCGG + Intronic
1082058419 11:47839485-47839507 GGCAAGACACAGTGGCAACTTGG + Intronic
1084579373 11:70013475-70013497 GCCATAACAAAGTGTCAGCTGGG + Intergenic
1085049239 11:73371564-73371586 GCAAACACTAAGTGGAAGCTGGG - Intergenic
1088092202 11:106055637-106055659 GGCTACATACACTGGCAGCTGGG - Intronic
1088565084 11:111162906-111162928 AGCAGGACAAAGTGGCAGCAAGG - Intergenic
1090180884 11:124698500-124698522 AGTAACACAAGGTGGAAGCTGGG - Intergenic
1090765727 11:129874432-129874454 GGCAACTAAGAGTGGCTGCTCGG - Intronic
1094276235 12:28678848-28678870 GGCAATGCTAAGTGCCAGCTGGG + Intergenic
1094589733 12:31809130-31809152 GGCACCACAAAATGGTAGCAGGG - Intergenic
1094827840 12:34286505-34286527 GGCCCCACACAGTGGCTGCTGGG - Intergenic
1094828121 12:34287646-34287668 GGCACCACAAAGTGGCAAGAAGG + Intergenic
1094831551 12:34302585-34302607 GGCACCGCACAGTGGCTGCTGGG - Intergenic
1094834445 12:34315744-34315766 GGCAACCCAAAATGGCAAGTAGG - Intergenic
1094834663 12:34316666-34316688 GGCCCCACACAGTGGCTGCTGGG + Intergenic
1094835435 12:34319952-34319974 GGCACCCCAAAGTGGCATCAAGG - Intergenic
1094838039 12:34331367-34331389 GGCAGCCCAAAGTGGCAGGAAGG - Intergenic
1094839758 12:34337955-34337977 GGCAGCACAAAGAGGCAGGGAGG + Intergenic
1094871772 12:34602826-34602848 GGCAACCCAAAGAGGCAGGAAGG + Intergenic
1094872149 12:34604514-34604536 GGCAGCACAAGGTGGCAGGAAGG + Intergenic
1094872196 12:34604704-34604726 GGCAGCCCAAAGTGGCAGGAAGG + Intergenic
1095243022 12:39883328-39883350 GGGAACACAAACTGGCAGTGAGG - Intronic
1101584161 12:106070109-106070131 GCCACCCCACAGTGGCAGCTTGG - Intronic
1101740377 12:107495451-107495473 AACAGCACACAGTGGCAGCTAGG - Intronic
1101809865 12:108098385-108098407 TGGAACACAACGTGGCAGCTGGG + Intergenic
1102034058 12:109760928-109760950 GGTTACAGAAAGAGGCAGCTGGG + Intronic
1112325016 13:98438330-98438352 GGCTATAAAAAGTGGCAGCAAGG - Intronic
1112967203 13:105211548-105211570 GGCAAGACACAGAGCCAGCTGGG - Intergenic
1119939152 14:78622181-78622203 GGCTAGTCAAACTGGCAGCTGGG - Intronic
1121375220 14:93403017-93403039 GACAACTCAAAATGGCAGGTGGG + Intronic
1121935574 14:98015376-98015398 GGAAACAAAGAGAGGCAGCTGGG + Intergenic
1122251273 14:100441531-100441553 GGGAACACAGAGGGGCAGCAGGG + Intronic
1122382219 14:101316373-101316395 GCCACCACAACGTGGCAGCAGGG - Intergenic
1123159107 14:106260329-106260351 GGGAAGACATAGTGGCTGCTGGG + Intergenic
1123160226 14:106271167-106271189 GGGAAGACATAGTGGCTGCTGGG + Intergenic
1202872000 14_GL000225v1_random:173437-173459 GGCAGCACCAAGTGGGAGCTGGG + Intergenic
1124379341 15:29151599-29151621 GGCAACACAAGGTGGCCTCCAGG + Intronic
1128115242 15:65101233-65101255 GGCAGCAGAAGGTGGCAGCGGGG - Intronic
1128333489 15:66771396-66771418 GGCAGAACAAAGTGGCGGCCTGG - Intronic
1128674117 15:69596196-69596218 GGCTTCAGAAAGTGGCATCTTGG + Intergenic
1135284697 16:21183221-21183243 GGGGACACAAGGTGGCACCTAGG + Intergenic
1138138635 16:54546864-54546886 GGCAACCCAAAATGGCAACATGG + Intergenic
1139474720 16:67197443-67197465 GCCAACAGACAGTGCCAGCTTGG + Intronic
1140477836 16:75247832-75247854 GCCAGCACAAGGTGGGAGCTGGG + Intronic
1143386433 17:6533956-6533978 GGCCACACAAAGAGGCAGAGCGG - Intronic
1143593996 17:7903242-7903264 GGCAAGAGAAAGTGGCGGGTGGG - Intronic
1144658154 17:17051257-17051279 TTCAAGACTAAGTGGCAGCTTGG - Intronic
1146007898 17:29173046-29173068 GGAAACACAAATTGGTAGGTTGG + Intronic
1149673055 17:58432821-58432843 GGCAAGAGAAAGTAGTAGCTTGG + Intronic
1153484228 18:5579760-5579782 GGCAACAGAAAGTCTGAGCTAGG + Intronic
1154005853 18:10526564-10526586 GGCAACCCAAAATGTCATCTGGG + Intronic
1155466278 18:26139217-26139239 GGCAACTCAACACGGCAGCTGGG - Intronic
1155757806 18:29523599-29523621 GGCAAGACATACTGGTAGCTTGG - Intergenic
1157329084 18:46690056-46690078 GGCATTACAAACTGGCATCTGGG + Intronic
1159334105 18:67041504-67041526 GTCAACTCATAGTGGCAGCGGGG + Intergenic
1161367876 19:3891501-3891523 CCCAATACAAGGTGGCAGCTGGG + Intronic
1165056183 19:33177534-33177556 GGCTCCCCCAAGTGGCAGCTTGG - Intergenic
1168267758 19:55231684-55231706 GGCAGCCCAAGGGGGCAGCTAGG + Intronic
925260088 2:2521356-2521378 GGCAACACAAATAGGAGGCTGGG - Intergenic
927177855 2:20422765-20422787 GGGACCAGAAAGAGGCAGCTAGG - Intergenic
930586651 2:53275360-53275382 GGCAACAGAATGTGACAGCCTGG + Intergenic
938249635 2:129804784-129804806 AGCAGCACAAAGCTGCAGCTTGG + Intergenic
939882040 2:147641898-147641920 GGCAAGAGATGGTGGCAGCTTGG + Intergenic
940967172 2:159852056-159852078 GGCAACACAGAGGGCCAGGTGGG + Intronic
941855678 2:170228017-170228039 GGCAAAAGAAAGGGGCAGCAAGG + Intronic
943701846 2:190995673-190995695 TGCAACACAAAATGTCACCTAGG + Intronic
1171755189 20:29100715-29100737 GGCAACACAATGTAGCCTCTAGG + Intergenic
1171787499 20:29482178-29482200 GGCAACACAATGTAGCCTCTGGG - Intergenic
1171860454 20:30397208-30397230 GGCAACACAATGTAGCCTCTAGG + Intronic
1173376125 20:42484895-42484917 GGAAGCAGAATGTGGCAGCTAGG - Intronic
1173862390 20:46292592-46292614 TGCAACTCAAAGTGGCATCTTGG + Intronic
1177005613 21:15668914-15668936 AAAAACCCAAAGTGGCAGCTGGG + Intergenic
1177256374 21:18668531-18668553 GGAATCACAAAGTGGAATCTAGG + Intergenic
1178705286 21:34867997-34868019 GGCCACACAGAGCTGCAGCTGGG + Intronic
1180028031 21:45179817-45179839 GGCAAGAGAAAGGGGCAGCTTGG - Intronic
1180286092 22:10746056-10746078 GGCAGCACCAAGTGGGAGTTGGG - Intergenic
1181580161 22:23823729-23823751 GCCAACACAGAGAGGCAGCAGGG + Intronic
1183193179 22:36335020-36335042 GGCACCAAAAAGGGGCTGCTGGG - Intronic
1184788221 22:46682169-46682191 GGGATCACAGAGGGGCAGCTGGG + Intergenic
952516053 3:34105679-34105701 GCCAACGCAAAGAGGGAGCTGGG - Intergenic
954367972 3:50156115-50156137 GCAAACCCAAGGTGGCAGCTGGG - Intronic
956645565 3:71452435-71452457 GGCAACTCAAAGAGCCAGCAAGG + Intronic
957849099 3:85782057-85782079 AGCTACACTAAGTGGCTGCTGGG - Intronic
959866315 3:111274347-111274369 AGCAAGACAAAGTTCCAGCTAGG + Intronic
962040843 3:131705987-131706009 GGCCACACCAGGTGGCAGCCAGG + Intronic
962311694 3:134331430-134331452 GGCTCCACAGAGGGGCAGCTGGG + Intergenic
963980915 3:151536062-151536084 GACAGGACACAGTGGCAGCTAGG - Intergenic
964557759 3:157959157-157959179 GGCAACTGAAAATGGCATCTGGG - Intergenic
964641491 3:158914188-158914210 AGCTAGACAAGGTGGCAGCTGGG - Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
969699809 4:8761915-8761937 GGCAGCACAGAGGAGCAGCTGGG + Intergenic
971911629 4:32802625-32802647 AGCTACAGCAAGTGGCAGCTAGG + Intergenic
972493771 4:39613516-39613538 GTCAACACAAACCAGCAGCTAGG + Intronic
975957612 4:79859980-79860002 GGCATAACAAACTGGCAGGTTGG - Intergenic
976572835 4:86633215-86633237 GGCCACACAGAGGGCCAGCTTGG - Intronic
977885896 4:102251339-102251361 GGCAACTCACATTAGCAGCTGGG + Intronic
980618214 4:135261984-135262006 GGCAAGACAGAGTGGTAGGTAGG - Intergenic
982313765 4:154010861-154010883 GCCAACACAACGTGGAAGCTAGG + Intergenic
984008411 4:174341617-174341639 AGCAACTGAATGTGGCAGCTAGG + Intergenic
984733426 4:183089187-183089209 GGCTACACAGAGGGGCAGCTGGG + Intergenic
987294160 5:16535576-16535598 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294174 5:16535656-16535678 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294181 5:16535696-16535718 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294188 5:16535736-16535758 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294217 5:16535896-16535918 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294224 5:16535936-16535958 GCCTTCACAAAGTGGGAGCTGGG + Intronic
990205930 5:53429691-53429713 GGCAAAAGAAGGTGGTAGCTAGG + Intergenic
990347053 5:54881488-54881510 TGCCACACTAAGTGGCTGCTTGG + Intergenic
990476151 5:56163409-56163431 GGTAACACAAAATGAGAGCTCGG - Intronic
990792862 5:59501559-59501581 GGCAGAAGAAAGAGGCAGCTGGG + Intronic
991185029 5:63796361-63796383 GGTGAGACAAAGTGGTAGCTTGG - Intergenic
992892857 5:81220034-81220056 GGCAACAGATATCGGCAGCTTGG - Intronic
997305525 5:132833013-132833035 GGCAACACCAAGGTCCAGCTGGG - Intergenic
998098612 5:139413186-139413208 GGTTAAACAAAGTGGCTGCTGGG + Exonic
998549439 5:143063280-143063302 GGAAAGACACAATGGCAGCTTGG - Intronic
998770617 5:145540513-145540535 GACAACAGAATGTGGCACCTAGG + Intronic
999296965 5:150465778-150465800 GGCAGCAAAGAGTGGCAGATGGG + Intergenic
999787025 5:154900287-154900309 GCCAACATAAAGTTGTAGCTGGG + Intronic
1000751022 5:165097151-165097173 GGCAAAACAAAGGGGCTGCAGGG + Intergenic
1001530642 5:172459123-172459145 GACAAGGCACAGTGGCAGCTGGG - Intergenic
1001568420 5:172715037-172715059 GGCATCACAAACAGGAAGCTGGG - Intergenic
1003260083 6:4509110-4509132 GGCAAGAGACAATGGCAGCTTGG - Intergenic
1004100975 6:12611043-12611065 GACAACACCAAGTGTCAGCAAGG + Intergenic
1006547760 6:34793238-34793260 GGCCACAAAAATTGGGAGCTAGG + Intronic
1009196961 6:60698177-60698199 GGAAACACAAAATGGCAGCCTGG + Intergenic
1012485415 6:99716034-99716056 GGCAACACCAAGTGCTAGCCAGG - Intergenic
1016051739 6:139537188-139537210 GGCAACAGCAAGAGGCACCTTGG - Intergenic
1017746530 6:157451922-157451944 GGGAACAAAAAGTGCCTGCTTGG + Intronic
1019863334 7:3681135-3681157 AGAAATACAAAGTGGCAGCCGGG - Intronic
1022584364 7:31592022-31592044 AGCAACATAAAATGGCAGATGGG + Intronic
1024282376 7:47730117-47730139 GAAACCACAAAGTGGGAGCTGGG - Intronic
1024922397 7:54573082-54573104 GTCAATACAAAGGGGCAGCCTGG - Intergenic
1029597384 7:101545111-101545133 GGGGACACTTAGTGGCAGCTTGG - Intronic
1030495115 7:110289050-110289072 GACAACTCAAAGTGGGAGTTGGG - Intergenic
1032405580 7:131653112-131653134 GGCCACACGAAATGGGAGCTAGG - Intergenic
1036218886 8:6903853-6903875 GGCAGCACAGAGTGGAAGCCAGG - Intergenic
1036575252 8:10021991-10022013 GGCAATGGAAAGGGGCAGCTGGG - Intergenic
1037883988 8:22586748-22586770 GGCAACACGATGGGGAAGCTCGG - Intronic
1039437462 8:37569888-37569910 GTCATCACAAAATGGCAGCAAGG + Intergenic
1040807058 8:51406601-51406623 GGGAACACCAGGTGGCATCTGGG - Intronic
1041125675 8:54636016-54636038 GCCAACAGAAAGAGGCAGCAGGG - Intergenic
1043304191 8:78773577-78773599 GGCAATACAGAGTGGCAAGTAGG + Intronic
1043962589 8:86434065-86434087 GGCAACAGATAATGGTAGCTTGG - Intronic
1050598872 9:7230907-7230929 GGCAACACATATTGCCAGTTTGG + Intergenic
1050823479 9:9913855-9913877 GGCAACATGCTGTGGCAGCTTGG - Intronic
1052815572 9:33100333-33100355 AGAAATACAAAATGGCAGCTTGG + Intergenic
1053747641 9:41216365-41216387 GGCAACACAATGTAGCCTCTGGG + Intergenic
1054338744 9:63834159-63834181 GGCAACACAACGTAGCCTCTAGG - Intergenic
1054479643 9:65649007-65649029 GGCAACACAATGTAGCCTCTGGG - Intergenic
1056277065 9:85003768-85003790 GGCAAAAGAATGTGGCAGCTTGG + Intronic
1056469828 9:86894546-86894568 GGCAACAAAAGGTGGCAATTTGG + Intergenic
1057297674 9:93859057-93859079 GGGAACTCAAAGTGGTGGCTGGG + Intergenic
1058934227 9:109753075-109753097 GGAAACTCCAAGTGGCATCTTGG - Intronic
1202783775 9_KI270718v1_random:27136-27158 GGCAACACAATGTAGCCTCTGGG + Intergenic
1203732446 Un_GL000216v2:103126-103148 GGCAGCACCAAGTGGGAGCTGGG - Intergenic
1203448095 Un_GL000219v1:79661-79683 GGCAACACAATGTAGCCTCTGGG - Intergenic
1185847696 X:3454381-3454403 GTCAACACAGAGAGGCTGCTAGG - Intergenic
1189205845 X:39238216-39238238 GGGAACACAAAGTGGGAGAGGGG - Intergenic
1189408012 X:40743370-40743392 GGCAACACAACGCTGCTGCTGGG - Intergenic
1191210134 X:57876000-57876022 GGCACAGCAAGGTGGCAGCTGGG - Intergenic
1192216434 X:69162578-69162600 GGCTACAAAAGGTGACAGCTCGG - Exonic
1193675511 X:84447619-84447641 GGCCTCTCAAAGTGGCATCTTGG - Intronic
1195014440 X:100764867-100764889 GGCAACAAGAACTGCCAGCTTGG + Intergenic
1195895374 X:109741006-109741028 GCAAACAAAAAGTGGCAGATAGG - Intergenic
1195995555 X:110728512-110728534 GGGAACACAAAGTCATAGCTAGG - Intronic
1196493275 X:116292937-116292959 GGCAACAAAAATGGGCATCTTGG + Intergenic
1196975619 X:121154699-121154721 GGCAACAAAAAGAAGCATCTTGG + Intergenic
1197670016 X:129266349-129266371 TGCAAGACAAACTGGCAGGTGGG - Intergenic
1198739690 X:139828484-139828506 TGCAACAGAAGGTGGGAGCTGGG - Intronic
1200816165 Y:7535083-7535105 GTCAACACAGAGAGGCTGCTAGG + Intergenic
1201570289 Y:15406527-15406549 TACATCACAATGTGGCAGCTAGG + Intergenic
1202628503 Y:56884460-56884482 GGCAGCACCAAGTGGGAGCTGGG + Intergenic