ID: 911664482

View in Genome Browser
Species Human (GRCh38)
Location 1:100538461-100538483
Sequence TTAGCCGGTGTCTCAGGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911664482_911664489 -3 Left 911664482 1:100538461-100538483 CCTCCCCCTGAGACACCGGCTAA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 911664489 1:100538481-100538503 TAAGGACCAGCCTAAACGCAAGG 0: 1
1: 0
2: 1
3: 5
4: 56
911664482_911664493 21 Left 911664482 1:100538461-100538483 CCTCCCCCTGAGACACCGGCTAA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 911664493 1:100538505-100538527 AACCTTCACCTCTTTCCCATGGG 0: 1
1: 0
2: 2
3: 16
4: 210
911664482_911664492 20 Left 911664482 1:100538461-100538483 CCTCCCCCTGAGACACCGGCTAA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 911664492 1:100538504-100538526 TAACCTTCACCTCTTTCCCATGG 0: 1
1: 0
2: 2
3: 20
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911664482 Original CRISPR TTAGCCGGTGTCTCAGGGGG AGG (reversed) Exonic
903004824 1:20291713-20291735 TTGGCCGGTGGCTCTGGGGATGG - Intronic
904245726 1:29186653-29186675 TGAGTCTGTGTCTCATGGGGAGG - Intergenic
909295674 1:73945294-73945316 TTAGCCTGAGTCTCACAGGGAGG - Intergenic
911664482 1:100538461-100538483 TTAGCCGGTGTCTCAGGGGGAGG - Exonic
917515307 1:175702286-175702308 TGAGCAGGCGTCTCAGTGGGTGG - Intronic
920871839 1:209801383-209801405 TTAGCCGGACTCTGCGGGGGTGG + Exonic
1069550827 10:69362836-69362858 TTAGCCGGCTTCTCTGGGGAGGG + Intronic
1069944966 10:71979361-71979383 TTAGACGGAGTCTCGGGAGGGGG + Intronic
1073138867 10:101234779-101234801 TTAGCCTGTGCCTCAGAGAGAGG + Intergenic
1075714049 10:124545631-124545653 CCAGCGGGTGTGTCAGGGGGCGG + Intronic
1076824131 10:132958827-132958849 TCAGCAGGTATCCCAGGGGGAGG - Intergenic
1077451311 11:2648191-2648213 TGAGACCGTGTCTCGGGGGGTGG + Intronic
1081652689 11:44835011-44835033 TTAGCCAATGTCTGAGGGTGTGG - Intronic
1088782103 11:113145771-113145793 ATGGCCTGTTTCTCAGGGGGTGG - Intronic
1092907803 12:13117796-13117818 ATTGCAGGTGTCTCTGGGGGAGG + Intronic
1097130103 12:56805291-56805313 TTAACCTGTGCCCCAGGGGGTGG + Intergenic
1104417225 12:128605652-128605674 TCAGCCGATGCCTCAGGAGGTGG - Intronic
1108298694 13:49052741-49052763 TTTTCAGGTGTCTCAGGTGGTGG + Intronic
1113784287 13:112994326-112994348 TGTGCCGGTGTCTCGGGCGGGGG + Intronic
1113956311 13:114101463-114101485 TTAGACACTGTCTCAGGGCGGGG - Intronic
1115028816 14:28770788-28770810 TTAGACAGTTGCTCAGGGGGAGG + Intergenic
1115472157 14:33779190-33779212 TCAGCCTGTGGCTCAGGGGCTGG - Intronic
1117486919 14:56207127-56207149 TTAGCATGTGTCTAAGGGTGAGG - Intronic
1120782260 14:88495578-88495600 TGAACCGGGGGCTCAGGGGGAGG + Intronic
1122750199 14:103927761-103927783 TAAACCGGTGTCTCAGGCGGCGG - Intronic
1125535249 15:40438628-40438650 TTATCTGGGGTCTCAGTGGGAGG - Intergenic
1132724905 16:1334296-1334318 TGGGCCGGGGTCTCCGGGGGAGG + Intronic
1135651148 16:24207938-24207960 CTGGAGGGTGTCTCAGGGGGTGG + Intronic
1140049028 16:71463204-71463226 TTAGGGGGTGTGTGAGGGGGTGG - Intronic
1140173969 16:72637246-72637268 TCAGCCCCTGTATCAGGGGGTGG + Intergenic
1146951178 17:36907629-36907651 TTAGCCGGGGTCGCAGCGGTGGG - Intergenic
1147571101 17:41571715-41571737 TTAGGCGGTGGCTTTGGGGGTGG - Exonic
1149516549 17:57285217-57285239 GTAGCCGGAGTTTCAGGGGAGGG + Intronic
1151950609 17:77351623-77351645 TTGGCCCATGTCTCAGGGGCAGG - Intronic
1152507446 17:80759490-80759512 TTGAGCGGTGTCTCAGGTGGCGG + Intronic
1162236786 19:9315829-9315851 ATAGCAGGTGTCCCAGGGGCAGG + Intergenic
1162256958 19:9498491-9498513 TTGGGCGGTGTTTCGGGGGGTGG - Intronic
1165246441 19:34500781-34500803 TTAGGCGGGGTCCCAGGAGGGGG + Exonic
1167403715 19:49290206-49290228 TTAGCTGGTGACTTAGGGGTAGG + Exonic
927830331 2:26344813-26344835 TCAGTCCCTGTCTCAGGGGGCGG + Intronic
929967719 2:46548063-46548085 TTAGCCACTGTCTCAGTGTGTGG + Intronic
931441386 2:62293142-62293164 CTAGCCAGTGTCTGAGGTGGAGG + Intergenic
937951135 2:127388495-127388517 TTAGCCAGTCTCCAAGGGGGTGG - Intergenic
943041557 2:182811192-182811214 TTGGCAGGTGCCTCAGGCGGAGG - Intergenic
945298393 2:208193398-208193420 TTAGTCTGGGTTTCAGGGGGAGG - Intergenic
948202098 2:236136590-236136612 ATGGCCTGTGTCTCAGGGGCCGG + Intergenic
948944293 2:241211606-241211628 GTGGCAGGTGTCTCAGGGAGAGG + Intronic
1170495524 20:16920360-16920382 TAAGCAGGAGTCTCAGTGGGTGG - Intergenic
1176300394 21:5096410-5096432 TTTGCTGGCGTCTCAGGTGGAGG - Intergenic
1179856650 21:44165571-44165593 TTTGCTGGCGTCTCAGGTGGAGG + Intergenic
1182330183 22:29546107-29546129 TTGGCCTGTGGCTCAGAGGGTGG - Intronic
1182451468 22:30424276-30424298 ATTGCCGGTGTTTCAGGGGGTGG + Exonic
1184564874 22:45285813-45285835 TTATGCGGTGGCCCAGGGGGAGG + Intronic
1185143320 22:49116068-49116090 ATAGATGGTGTCTCAGTGGGCGG + Intergenic
1185256704 22:49837741-49837763 GTTGCCGGGGTCTCAGGGAGGGG + Intergenic
953929765 3:47000057-47000079 TCAGCAGGTGACTCAGTGGGTGG - Exonic
960997205 3:123348111-123348133 TTAGCTGGTGTCCCGGGGAGGGG - Intronic
962852000 3:139314899-139314921 TTAGCTGGTATCTCATAGGGTGG + Intronic
968089565 3:195891884-195891906 TTAGCTGGTGTTTCAGGGAGAGG - Intronic
969603157 4:8188878-8188900 CTCTCCGGTGTCCCAGGGGGAGG + Intronic
971375241 4:26050892-26050914 GAAGCTGGTGTCTCAGGGAGGGG - Intergenic
972846708 4:43000181-43000203 TTAGAAGGCGTCTAAGGGGGTGG + Intronic
993929877 5:93924748-93924770 TTAGCTGGAGGGTCAGGGGGAGG + Intronic
1001152595 5:169245257-169245279 TTAGCTGGGGTCTCAGTGAGAGG - Intronic
1005380222 6:25225957-25225979 TGAGACTTTGTCTCAGGGGGCGG + Intergenic
1007415096 6:41687070-41687092 TGAGCAGGTTTCTGAGGGGGAGG - Intronic
1007597376 6:43059869-43059891 TCAGTCGGTGGCGCAGGGGGCGG - Exonic
1009992701 6:70863572-70863594 TTGGCCAGTGTCCCAGGGGCAGG - Intronic
1019302911 7:317866-317888 TTAGCCTGTGTCACTGGGGAGGG - Intergenic
1022732828 7:33046502-33046524 TCAGCCTGTGTGACAGGGGGAGG + Intronic
1028635714 7:92986857-92986879 TTAGCCTGTGTCTCCAGGGAAGG + Intergenic
1032427700 7:131834678-131834700 TTAGCAGGAGCCCCAGGGGGAGG + Intergenic
1035018546 7:155787357-155787379 TTAGCCGCGGGCTCAGGCGGGGG - Intergenic
1036775254 8:11607439-11607461 ACAGCCACTGTCTCAGGGGGTGG - Intergenic
1045118764 8:99013064-99013086 CTAGGAGGTGTCTAAGGGGGTGG - Intergenic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1047379103 8:124339794-124339816 TTAGCCAGTGTCCCAGAAGGTGG - Intronic
1047817550 8:128481405-128481427 TTAACAGGAGTCTCAGGGGATGG - Intergenic
1060934192 9:127506251-127506273 TTAGGGGGTGCCTCATGGGGTGG - Exonic
1062479855 9:136746243-136746265 TTCGCCCGTGACTCAGGGGAAGG + Intronic
1062479887 9:136746323-136746345 TTCGCCCGTGACTCAGGGGAAGG + Intronic
1187273663 X:17800926-17800948 TCATACAGTGTCTCAGGGGGAGG + Exonic
1189609101 X:42713106-42713128 TTAGCCGGTGACTCAAAGTGAGG + Intergenic