ID: 911665904

View in Genome Browser
Species Human (GRCh38)
Location 1:100551344-100551366
Sequence CAGTGTTAACATCATGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911665902_911665904 -5 Left 911665902 1:100551326-100551348 CCAACAACTGTTCGAGAACAGTG No data
Right 911665904 1:100551344-100551366 CAGTGTTAACATCATGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911665904 Original CRISPR CAGTGTTAACATCATGTGGT AGG Intergenic
No off target data available for this crispr