ID: 911666543

View in Genome Browser
Species Human (GRCh38)
Location 1:100559283-100559305
Sequence CTTTATTTGCAGATGAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911666543_911666545 19 Left 911666543 1:100559283-100559305 CCAGGCTTCATCTGCAAATAAAG No data
Right 911666545 1:100559325-100559347 AGGCAAGATTCATATACAGTTGG No data
911666543_911666544 -1 Left 911666543 1:100559283-100559305 CCAGGCTTCATCTGCAAATAAAG No data
Right 911666544 1:100559305-100559327 GATATCTCATCAGAGTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911666543 Original CRISPR CTTTATTTGCAGATGAAGCC TGG (reversed) Intergenic
No off target data available for this crispr