ID: 911670068

View in Genome Browser
Species Human (GRCh38)
Location 1:100597809-100597831
Sequence CTGGATAAGGGGATGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911670060_911670068 27 Left 911670060 1:100597759-100597781 CCATAAAATGTAACTTTAATCAA No data
Right 911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911670068 Original CRISPR CTGGATAAGGGGATGGAGGA TGG Intergenic
No off target data available for this crispr