ID: 911675295

View in Genome Browser
Species Human (GRCh38)
Location 1:100651911-100651933
Sequence CTATCACCACAGAAAGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911675295_911675296 -6 Left 911675295 1:100651911-100651933 CCTCTTTCTTTCTGTGGTGATAG No data
Right 911675296 1:100651928-100651950 TGATAGTGCTAGTGCAAACATGG 0: 1
1: 0
2: 0
3: 6
4: 90
911675295_911675297 17 Left 911675295 1:100651911-100651933 CCTCTTTCTTTCTGTGGTGATAG No data
Right 911675297 1:100651951-100651973 TGAATATTTCTAAGACCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911675295 Original CRISPR CTATCACCACAGAAAGAAAG AGG (reversed) Intergenic
No off target data available for this crispr