ID: 911679266

View in Genome Browser
Species Human (GRCh38)
Location 1:100695479-100695501
Sequence CTGTCTAAGTGGAAGATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911679264_911679266 -7 Left 911679264 1:100695463-100695485 CCTCATGCTGTTCGGTCTGTCTA No data
Right 911679266 1:100695479-100695501 CTGTCTAAGTGGAAGATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911679266 Original CRISPR CTGTCTAAGTGGAAGATGCA TGG Intergenic
No off target data available for this crispr