ID: 911679605

View in Genome Browser
Species Human (GRCh38)
Location 1:100699851-100699873
Sequence CCTGTCTTGAGACCAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911679605_911679607 -10 Left 911679605 1:100699851-100699873 CCAGATTTTGGTCTCAAGACAGG No data
Right 911679607 1:100699864-100699886 TCAAGACAGGAAGTTAAATCTGG No data
911679605_911679608 10 Left 911679605 1:100699851-100699873 CCAGATTTTGGTCTCAAGACAGG No data
Right 911679608 1:100699884-100699906 TGGCCCTTGTTACTTCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911679605 Original CRISPR CCTGTCTTGAGACCAAAATC TGG (reversed) Intergenic
No off target data available for this crispr