ID: 911681383

View in Genome Browser
Species Human (GRCh38)
Location 1:100719785-100719807
Sequence CCTCCCAGGCACACACAGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 280}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911681374_911681383 22 Left 911681374 1:100719740-100719762 CCGCGGTATCTGCATCGGGCCTC 0: 1
1: 0
2: 1
3: 2
4: 38
Right 911681383 1:100719785-100719807 CCTCCCAGGCACACACAGGTGGG 0: 1
1: 0
2: 2
3: 22
4: 280
911681377_911681383 3 Left 911681377 1:100719759-100719781 CCTCACTGGCTTCAGGAGCTGAA 0: 1
1: 0
2: 1
3: 40
4: 913
Right 911681383 1:100719785-100719807 CCTCCCAGGCACACACAGGTGGG 0: 1
1: 0
2: 2
3: 22
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911681383 Original CRISPR CCTCCCAGGCACACACAGGT GGG Exonic
900001820 1:18649-18671 CCTCCAGGGCACACAGAGGATGG + Intergenic
900021540 1:189172-189194 CCTCCAGGGCACACAGAGGATGG + Intergenic
900163556 1:1235797-1235819 GATCCCAGCCAGACACAGGTGGG - Intergenic
900680491 1:3913576-3913598 CCTCCCAGGGACGCCCAGGCAGG + Intergenic
900685101 1:3943256-3943278 CCTCCGAGGCAGTCACTGGTGGG + Intergenic
901750503 1:11404202-11404224 GCTCCCAGGGTCACACAGCTGGG - Intergenic
902777246 1:18682758-18682780 CTTCCCAGGCAGACCCAGGAGGG - Intronic
904935227 1:34125443-34125465 GCTCCAGGGCACACACAGGTAGG + Intronic
905470152 1:38185725-38185747 CCTCCCTGGCAGACACTGGGAGG + Intergenic
906608908 1:47188978-47189000 CCTCCCATGCACATACAGCAAGG + Intronic
907419353 1:54336457-54336479 GCTCCCATGCACACGCAGGTGGG + Intronic
911681383 1:100719785-100719807 CCTCCCAGGCACACACAGGTGGG + Exonic
912853559 1:113147578-113147600 CCTCCCAGCCACACACACTCTGG + Intergenic
913233924 1:116764337-116764359 ACTCCCAGGCTCACAGAGGGTGG - Intronic
915339009 1:155166324-155166346 CCTCCCAAGCAAACAATGGTGGG - Intergenic
916172779 1:162013255-162013277 CTTCCCAGCCACTCACAGGAAGG + Intronic
917065231 1:171085778-171085800 CCACCGAGGAACACACAGGAAGG - Intergenic
917725888 1:177826672-177826694 CCTCCCAGTGACAAGCAGGTGGG - Intergenic
920367019 1:205453536-205453558 CTTCCCAGGCAAACAGAGGGAGG + Intronic
921284489 1:213596908-213596930 CCACCCTGGCTCACAGAGGTAGG - Intergenic
921985339 1:221306162-221306184 CCTCCCAGGCAGGGACAGGGTGG + Intergenic
922359122 1:224804952-224804974 CCACCCAGCCCCACACATGTAGG + Intergenic
1066534858 10:36380674-36380696 CCTCCCATGGACACTCAGATGGG + Intergenic
1067185990 10:44028792-44028814 CGTCCCAGGCACTCAAAGGCAGG - Intergenic
1067713899 10:48672076-48672098 CTGCCCAGGGACACACAGGAGGG - Intergenic
1069761419 10:70814230-70814252 CCTCCCAAAGACACACAGGCAGG - Intergenic
1070254801 10:74804832-74804854 CCTCCCAGGGAGGCAGAGGTGGG + Intergenic
1071255018 10:83864591-83864613 CCCTCCAGGCACACACAGCTAGG - Intergenic
1071611793 10:87038622-87038644 CTGCCCATGCACACACATGTTGG + Intergenic
1072249030 10:93567295-93567317 CCTGCCCGGCACACACAGAGGGG - Intronic
1073023909 10:100471719-100471741 CCACCCAGCCTCACACAGCTAGG - Intronic
1073467585 10:103703201-103703223 CCTCCCAGGGCCATGCAGGTGGG - Intronic
1075241516 10:120783286-120783308 ACACACAGGCACACACATGTAGG - Intergenic
1075897407 10:126008992-126009014 CCTCCAGGGCACACACAGCAGGG - Intronic
1076103310 10:127800070-127800092 CCTCACAGACACACCCAGGATGG - Intergenic
1076501686 10:130942149-130942171 CCTCCAAGGCATAGACAGGGCGG + Intergenic
1076504323 10:130962028-130962050 CCTGCGAGGCACACAGAGATGGG - Intergenic
1076727889 10:132421829-132421851 CCCCCCAGCCACACCCAGGAAGG - Intergenic
1077191270 11:1256811-1256833 CGACCCAAGCACACACAGGGTGG + Intronic
1077211898 11:1375057-1375079 CCTTCCAGGGACTCAGAGGTGGG - Intergenic
1077791772 11:5448734-5448756 CCTCCCAGAAACAGACAGATGGG - Intronic
1079349515 11:19680510-19680532 CCTCACCCGCACACACAGGAGGG + Intronic
1079689698 11:23404780-23404802 CCTCCCAGGGACTCTCAGATGGG - Intergenic
1084380381 11:68808060-68808082 CCTGCCGGGGACGCACAGGTCGG - Intronic
1084458221 11:69281184-69281206 TCACCCAGGCACACCCAGGAGGG + Intergenic
1084489554 11:69471073-69471095 CCTCCCAGGCCCCCACCCGTGGG - Intergenic
1084677229 11:70642594-70642616 CCTCCCACGGACACAGAGGCCGG + Intronic
1088538638 11:110888743-110888765 CTCCCCAGGGACACACAGTTAGG - Intergenic
1088847597 11:113681375-113681397 CCACCCAGGCCCACCCAGGCAGG + Intergenic
1089195917 11:116693977-116693999 CCTCCAAGGGACCCACAGGCGGG + Intergenic
1089384689 11:118060033-118060055 CCTCCTGGGCCCTCACAGGTGGG - Intergenic
1089483532 11:118827086-118827108 TCACCCAGGCACATACAGGCTGG + Intergenic
1090350355 11:126104094-126104116 CCTACCTGACTCACACAGGTAGG + Intergenic
1090392519 11:126398377-126398399 CCTTCCAGACACACTCGGGTAGG + Intronic
1090466463 11:126939035-126939057 CCTGCCAGGCACACATAGTACGG + Intronic
1090746482 11:129709664-129709686 CCGGCCAGGAACACACAAGTTGG + Intergenic
1091374901 12:18754-18776 CCTCCAGGGCACACAGAGGATGG + Intergenic
1092033616 12:5311092-5311114 CCACCTAGGCACACACAGGATGG + Intergenic
1092756079 12:11764708-11764730 CCTCCCTGTCACACACACATAGG - Intronic
1094016889 12:25874366-25874388 CCTCACACACACACACAGGAGGG + Intergenic
1095529629 12:43171310-43171332 CCTCCCAGGCACTCCCACGAAGG + Intergenic
1097279305 12:57834722-57834744 CCTCCCCATCACACACAGATGGG - Intronic
1101089815 12:101273741-101273763 CCTCCCAGGCTCACACACTTGGG - Intergenic
1102441620 12:112967992-112968014 GCTCCCAGGCATACACAGTCAGG - Exonic
1103068982 12:117925012-117925034 ACTCCCACACACACACAAGTAGG + Intronic
1105433324 13:20357239-20357261 CCTCCCAGCCACACCCACTTAGG - Intergenic
1105522050 13:21140126-21140148 CCTTCCAGCCACACACAGTTCGG - Intergenic
1105599589 13:21874886-21874908 CCTCTCAGGCACTCACTGCTTGG + Intergenic
1105889115 13:24669365-24669387 GGTGCCAGGCACACAAAGGTTGG - Intergenic
1108572077 13:51761704-51761726 CATCCCAGGGAAACACACGTAGG - Exonic
1112236023 13:97637466-97637488 CCACCCAGACACACTCAAGTTGG + Intergenic
1112829862 13:103436391-103436413 TCTCCCAGGCAGACACAGAAGGG - Intergenic
1113785854 13:113001841-113001863 CTTCCCGGGCACACAAAGGATGG - Intronic
1113791150 13:113029122-113029144 CCTCCCAAATTCACACAGGTTGG - Intronic
1114482819 14:23046028-23046050 CTCCAGAGGCACACACAGGTAGG - Intergenic
1117078941 14:52131929-52131951 CCTCCCAGCCTAACATAGGTAGG - Intergenic
1118014074 14:61640632-61640654 CCTCCCAGGCTGACACAGGTGGG - Intronic
1118353117 14:64988280-64988302 CTTCCCTGGGACACACTGGTAGG - Intronic
1119616195 14:76100641-76100663 CCTCCCTGGCAGACCCAGGGAGG - Intergenic
1119738402 14:76998712-76998734 CCTCCAGAGCACTCACAGGTTGG - Intergenic
1119756627 14:77124550-77124572 TCGCCCAGGAACACACAGCTGGG - Intronic
1120904359 14:89607590-89607612 CTGCCCATGCACACAGAGGTGGG + Intronic
1122125362 14:99575813-99575835 CCACCCAGGGACACCCAGGCTGG + Intronic
1125062215 15:35437969-35437991 CCTCCCAGGGACTCAGAGGAAGG - Intronic
1125796345 15:42406741-42406763 CCTGCCAGGCACACACTGGCAGG - Intronic
1127786598 15:62360939-62360961 CCTCACACACACACACAGGGTGG + Intergenic
1127796640 15:62444072-62444094 CCTCCAAGGCTCACATCGGTAGG - Intronic
1128085350 15:64882666-64882688 CCTCCCATGGGCACACAGTTTGG + Intronic
1128235547 15:66064946-66064968 CCTTCCAGACACTCCCAGGTTGG - Intronic
1128543550 15:68552841-68552863 CCTCCCAGGAGCAGACAGGAAGG + Intergenic
1128602726 15:69011388-69011410 CCTCACAGGCACTCACAAGCCGG + Intronic
1129111689 15:73340744-73340766 CCACCCAGGCCAGCACAGGTGGG + Intronic
1129514757 15:76150596-76150618 CCTCCCAGCCACAGACAGCCTGG + Intronic
1130080015 15:80724684-80724706 CCTCCCAGACCCACAGAGCTTGG - Intronic
1130921090 15:88345111-88345133 CCACTCAGGCACACAGAGCTGGG - Intergenic
1131668838 15:94598062-94598084 CCTCCCACACACACACACTTAGG + Intergenic
1131984880 15:98033135-98033157 CCTTCCAGGAACTCACAGCTTGG + Intergenic
1132451689 15:101972291-101972313 CCTCCAGGGCACACAGAGGATGG - Intergenic
1132455203 16:18338-18360 CCTCCAGGGCACACAGAGGATGG + Intronic
1133001814 16:2855727-2855749 CCTTCCAGGAATACACAGGGTGG + Exonic
1133390915 16:5409235-5409257 CATCGCAGCCACACACAGGAAGG - Intergenic
1134113468 16:11530829-11530851 CTTCCCAGGCAGACTCGGGTAGG - Intergenic
1136284464 16:29233018-29233040 TCTCCCAGGCAGACCCAGGGCGG + Intergenic
1138561953 16:57806400-57806422 CCTCCCAGGCACCAGCAGGCGGG + Intronic
1139037362 16:62963356-62963378 CGTCCCAGGCCCAGACAGCTGGG - Intergenic
1139566602 16:67781369-67781391 CCTCCCAGGCTGACCCAGGCAGG - Intronic
1140767276 16:78172038-78172060 TTTCCCAGGCTCACACAGCTGGG + Intronic
1141274881 16:82578308-82578330 CCTCCAACACACACAAAGGTAGG - Intergenic
1142089499 16:88202531-88202553 TCTCCCAGGCAGACCCAGGGCGG + Intergenic
1142184576 16:88688461-88688483 CCCCCCAGGGACACTCAAGTCGG + Intergenic
1143167132 17:4902366-4902388 CCTCCCAGGCAGCGCCAGGTGGG - Exonic
1147153688 17:38532672-38532694 CCTCCCACTCACACCCAAGTGGG - Exonic
1147184059 17:38704299-38704321 CCCCCCTTGCCCACACAGGTTGG + Intergenic
1147603943 17:41763422-41763444 GTTCCCGGGCACACACAGGCAGG - Intronic
1147935482 17:44008198-44008220 CTTGCCAGGCGCACACAGGAAGG - Intronic
1148209131 17:45797699-45797721 TCTCCCAAGGTCACACAGGTAGG + Intronic
1150579215 17:66457031-66457053 CCTCCCATGGCCACACAGCTGGG - Intronic
1150644542 17:66969697-66969719 CCGCCCAGGTGCCCACAGGTGGG + Intronic
1151651357 17:75471987-75472009 TCTCCCAGGCAAAAACAAGTAGG - Intronic
1152296508 17:79470250-79470272 TGTCCCAGGTACACACATGTGGG - Intronic
1158178681 18:54687213-54687235 TCTCCTAGACACACACAGGATGG - Intergenic
1158458069 18:57624730-57624752 CCTTCCACACACACTCAGGTGGG + Intergenic
1159559537 18:69978747-69978769 CCTCACAGACACACCCAGGATGG + Intergenic
1160481284 18:79242000-79242022 CCTCTCCTGCACACACAGGTGGG - Intronic
1160580831 18:79883961-79883983 CCACCCAGGCACACCCGAGTTGG - Intronic
1160633572 19:60257-60279 CCTCCAGGGCACACAGAGGATGG + Intergenic
1160717441 19:582693-582715 CCTCCCAGCGACCCACAGGCGGG - Intronic
1160752937 19:743243-743265 CTTCCCAGGGCCACACAGCTGGG - Intronic
1161381717 19:3968937-3968959 CCTCCAAGGCCCAGACAGGCAGG + Intronic
1162301693 19:9848408-9848430 CATCCCAGGCCCACCAAGGTGGG + Intronic
1163116976 19:15195014-15195036 CCACGCAGGCACACACAGACAGG + Intronic
1163144932 19:15373722-15373744 ACTCCCATGCGCACAAAGGTGGG + Intronic
1163494742 19:17639751-17639773 CCTCCCATGCACACACCTGCTGG + Intronic
1163630343 19:18415230-18415252 CCTCCCACGCACGCACGGCTGGG + Intergenic
1164137456 19:22427649-22427671 CCTGGCAGCCACACACAGGGAGG - Intronic
1164160751 19:22624047-22624069 CCTGGCAGCCACACACAGGGAGG + Intergenic
1164244061 19:23415588-23415610 CCTCCTACGCACACACGAGTCGG + Intergenic
1164745153 19:30606694-30606716 ACTCCCAGGCACAAACGGGAGGG + Intronic
1165045671 19:33103063-33103085 GCTCACAGGCACACTCAGGAGGG + Intronic
1165161822 19:33820829-33820851 GCTCCCAGGAGCACAGAGGTGGG + Intergenic
1166142981 19:40815351-40815373 CCAGCCAGGGACACAGAGGTCGG - Intronic
1166184579 19:41131480-41131502 CCAGCCAGGGACACAGAGGTTGG + Intergenic
1166745908 19:45141790-45141812 CCTCCCAGCCACACAGGAGTTGG + Intronic
1166854850 19:45778362-45778384 ACTCCCAGGCACCCCCCGGTGGG + Intronic
1166945486 19:46393691-46393713 CGTGCCAGGCACACGGAGGTGGG + Intergenic
925576989 2:5370393-5370415 CCTGCCTGGCACACGCAGATGGG - Intergenic
926173481 2:10568937-10568959 TGTCCCAGGCACGCACAGCTGGG - Intergenic
926987207 2:18638273-18638295 CCTCACAGACACACCCAGGAAGG - Intergenic
927209873 2:20632521-20632543 CTTCCCAGGATCACACAGGAGGG - Intronic
927639952 2:24840031-24840053 CCTGCCAGGTACACACAGAAAGG + Exonic
930023021 2:47012767-47012789 CCTCCCAAGCACAAAGAGGCTGG + Intronic
932691406 2:73916815-73916837 CCTCCGAGGAACTCCCAGGTAGG - Intronic
932793417 2:74674870-74674892 CCTCCCTGGAATTCACAGGTTGG - Exonic
934555049 2:95282623-95282645 CCTGCCAAGCTCACGCAGGTGGG + Intronic
934856263 2:97732326-97732348 CCACACAGACCCACACAGGTAGG - Intronic
935343105 2:102075892-102075914 CCTCCCTGGCACAGATAAGTTGG - Intronic
935848026 2:107187719-107187741 CCACCCAGGCACACACATTCTGG - Intergenic
936270234 2:111043491-111043513 CGCCGCAGTCACACACAGGTGGG + Intronic
936567900 2:113594758-113594780 CCTCCAGGGCACACAGAGGATGG - Intergenic
937233427 2:120415975-120415997 CCTCCCTGGCACTCAGGGGTGGG + Intergenic
937325039 2:120985309-120985331 CCTCCTAGGCCCAGGCAGGTGGG + Intronic
938178707 2:129160828-129160850 CCTCCAGGGAGCACACAGGTAGG + Intergenic
938502182 2:131835979-131836001 CCCCCCACGCCCTCACAGGTGGG - Intergenic
939547596 2:143572277-143572299 CTCCAAAGGCACACACAGGTGGG - Intronic
940914625 2:159240717-159240739 CTTTCCAGGGTCACACAGGTAGG + Intronic
941991687 2:171563268-171563290 CAGCCCTGGCACACACAGGCAGG + Intergenic
942853374 2:180517577-180517599 CCTCCTAGGAACACAAAGCTGGG + Intergenic
945039776 2:205733941-205733963 CCCCGCAGGCCCACACAGATGGG + Intronic
945222969 2:207503492-207503514 CCTCCCATGCACACACTGCATGG + Intergenic
945761415 2:213920441-213920463 CCACCCACGTACACACATGTTGG + Intronic
947807195 2:232976998-232977020 CCTCCCAGGCACTCCCGGGAAGG - Intronic
947820088 2:233063350-233063372 CCTCCCAGGCCCCCTCTGGTGGG + Intronic
948244918 2:236472835-236472857 CTTCCCAGGCAGACAGAGCTAGG - Intronic
948450696 2:238069349-238069371 CCTCAAAGGGACACACAGGTGGG + Exonic
948751059 2:240133517-240133539 CCAGGCAGGCAAACACAGGTGGG + Intronic
948943054 2:241205618-241205640 GCTCCCAGCCTGACACAGGTGGG + Intronic
948943099 2:241205848-241205870 GCTCCCAGCCTGACACAGGTGGG + Intronic
948943129 2:241205996-241206018 GCTCCCAGCCTGACACAGGTGGG + Intronic
948943163 2:241206170-241206192 GCTCCCAGCCTGACACAGGTGGG + Intronic
948943215 2:241206432-241206454 GCTCCCAGCCTGACACAGGTGGG + Intronic
948943261 2:241206662-241206684 GCTCCCAGCCAGACACAGGTGGG + Intronic
948943291 2:241206810-241206832 GCTCCCAGCCTGACACAGGTGGG + Intronic
948943326 2:241206984-241207006 GCTCCCAGCCTGACACAGGTGGG + Intronic
949076368 2:242061347-242061369 CTCCCCAGACACACCCAGGTGGG + Intergenic
1168961530 20:1873373-1873395 CTTCCCAGAGTCACACAGGTAGG + Intergenic
1172028068 20:31962915-31962937 CCTCCCAGGGACAGATGGGTGGG + Intergenic
1172061099 20:32188142-32188164 CCTCCCCAGCACCCACAGCTTGG + Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172744323 20:37194805-37194827 CTGCCCAGGCACACACTGGCTGG - Intronic
1174367380 20:50064708-50064730 CCTCCCAGGCACACACAGAGGGG + Intergenic
1174955295 20:55091178-55091200 GGTCCCAGGCAAACTCAGGTGGG - Intergenic
1177570067 21:22875593-22875615 GCTCTCAAGCACACACAAGTTGG - Intergenic
1179004833 21:37504254-37504276 TCTCCCAGGCACAGAGAGTTAGG - Intronic
1179569020 21:42267167-42267189 CCACCCAGGCTCACAGAGGCCGG + Intronic
1179944901 21:44666560-44666582 GCTCACAGGCACGCACAGGGAGG + Exonic
1180099356 21:45577249-45577271 CCCCCCAGGCACTCCCAGGGTGG + Intergenic
1180147282 21:45928506-45928528 CCACCCAGGAGCACACAGCTGGG + Intronic
1181026599 22:20131082-20131104 CCCCCCAGACACACACACGCCGG - Intronic
1183296522 22:37032942-37032964 CCTGCCTCGAACACACAGGTTGG - Intergenic
1183484437 22:38081721-38081743 CCTCCCTGGCCCCCACAGGAGGG + Intronic
1183505599 22:38207055-38207077 CCTGCCAGGGCCACACAGGGAGG + Intronic
1184289397 22:43490342-43490364 CTTCCCAGGGTCACACAGGGAGG - Intronic
1184506580 22:44907403-44907425 CCACACAAGCACACAGAGGTGGG - Intronic
1184587263 22:45456449-45456471 CGTCCCAGTCACACAGAGCTGGG + Intergenic
1185074377 22:48675461-48675483 CCTCCCAGGATCCCACAAGTGGG - Intronic
950544111 3:13628823-13628845 CCTCCCAGGGCCACACTGGGAGG - Intronic
950620252 3:14199836-14199858 CACCACAGGCTCACACAGGTAGG - Exonic
952238783 3:31508229-31508251 CCTCCCAAGCACATACATGTAGG - Intergenic
954415532 3:50391486-50391508 CCTCCCATGCCCCCACAGGTGGG - Intronic
960054735 3:113269081-113269103 GCCTCCAGGCACACACAGGAAGG + Intronic
961404075 3:126666686-126666708 CATCCCAGGGCCACACAGCTAGG + Intergenic
962688095 3:137866759-137866781 AGTCCAAGGCACTCACAGGTTGG + Intergenic
963094327 3:141519774-141519796 TCTCCGTGGCACACAAAGGTTGG + Intronic
963127169 3:141827107-141827129 CCACCCAGCACCACACAGGTAGG + Intergenic
968443026 4:634081-634103 CCTCCCAGGCACACACTCCCAGG - Intronic
968689380 4:1982829-1982851 ACTCCCAGGCAGGCACAGGCAGG + Exonic
968913702 4:3488086-3488108 CCTCCCAGGCACAGGCAGGGAGG + Intronic
968934194 4:3601463-3601485 CCTCCCTTGCACACAGAGGAGGG - Intergenic
968974437 4:3813780-3813802 GCTCCCACGCACACACACTTCGG + Intergenic
969100031 4:4761889-4761911 GCTCCAAAGCACACACAGCTGGG - Intergenic
969573986 4:8025746-8025768 CCTCTCAGGGACTCACAGTTGGG + Intronic
970450194 4:16158555-16158577 CGTTCCTGGCACACACAGGCAGG - Intergenic
970701044 4:18738917-18738939 CCTCCCAGACACACTGGGGTGGG + Intergenic
971556507 4:28019054-28019076 TAAGCCAGGCACACACAGGTTGG + Intergenic
978596191 4:110379679-110379701 CCACCCATGCACACACATGCTGG - Intronic
979761501 4:124410906-124410928 TCTTCCTGGCACAAACAGGTAGG - Intergenic
981617915 4:146661891-146661913 CCTTCCAGGCCCAGAAAGGTGGG - Intergenic
981765534 4:148244595-148244617 CATCCCAGGAACACACATGCAGG + Intronic
984575576 4:181444202-181444224 CCTTCCAGGAACACACTGGTTGG + Intergenic
984843913 4:184093912-184093934 CCTCCCACCCACACACAGCAAGG - Intronic
985579417 5:689119-689141 CCTTCCTGGCCCACAGAGGTGGG - Intronic
985594263 5:781178-781200 CCTTCCTGGCCCACAGAGGTGGG - Intergenic
985996117 5:3597919-3597941 CCTCCCCCGCAAACACAGGCAGG - Intronic
988158875 5:27493249-27493271 CCTCCCAGGCTCCTACATGTTGG + Intergenic
989523352 5:42425331-42425353 CTTCCCAGGCACACACACCAGGG - Intronic
989714385 5:44443742-44443764 CCTCCCATACACACACACTTTGG + Intergenic
990051212 5:51503966-51503988 CTTACCAGGCACTCACAGGGAGG - Intergenic
997440365 5:133904907-133904929 CATCCCAGAAACACACTGGTAGG + Intergenic
1001851620 5:174972533-174972555 CCTCCCAGGCACAGAACAGTGGG - Intergenic
1002183353 5:177442632-177442654 CCCCACAGGCGCACACAGGAAGG - Intronic
1002444185 5:179279121-179279143 GGTCCCAGTCATACACAGGTGGG - Intronic
1002825332 6:767728-767750 CCTCCAACACACACACATGTTGG - Intergenic
1003573270 6:7269826-7269848 CCCTCCAGGCACCCACAGTTAGG - Intronic
1005438566 6:25840377-25840399 ATTCCCAGGCACATCCAGGTTGG + Intronic
1005835463 6:29705532-29705554 CATCACAGGGACACACAGGATGG - Intergenic
1006003351 6:30983797-30983819 CTTCCCAGGAACACAAACGTAGG + Exonic
1006633520 6:35446185-35446207 CTTCCCAGGCAGCCACAGGTAGG - Intergenic
1006927301 6:37664173-37664195 CCTCCCAGATACACTCAGGAGGG - Intronic
1008543247 6:52564093-52564115 GGTCCCATGCACACACAGGATGG - Intronic
1011723051 6:90178839-90178861 TCTCCCAGGAACACACTGGGTGG - Intronic
1013184977 6:107749679-107749701 CCCCACAGGCTCTCACAGGTAGG - Exonic
1013521696 6:110939289-110939311 CTTCCCTGGCACAGACACGTGGG + Intergenic
1013696713 6:112710890-112710912 CCACCCAGTCACACACAGACAGG - Intergenic
1018133710 6:160757544-160757566 GCCCCCAGGAACACACAGCTGGG + Intergenic
1019129456 6:169863025-169863047 CAGCCCAGGCACACACAGGGAGG - Intergenic
1021144906 7:17073500-17073522 CCTACTAGGAACACCCAGGTCGG + Intergenic
1024074545 7:45811854-45811876 CCTCCCACGCTGACAAAGGTCGG + Intergenic
1024074916 7:45813376-45813398 CCTCCCACGCTGACAGAGGTCGG + Intergenic
1024290954 7:47803609-47803631 TCTAGCAGGCACACACAGATGGG + Intronic
1025052431 7:55742055-55742077 CCTCCCACGCTGACAGAGGTCGG - Intergenic
1029176954 7:98671373-98671395 CCTCCTAGGCACACAAAAGACGG - Intergenic
1030190477 7:106805711-106805733 CCACCCAGGTACAGACAGGAAGG + Intergenic
1031642406 7:124180970-124180992 CCTAGCAGGCAGACACAGGTGGG - Intergenic
1032090614 7:128909902-128909924 CTTCCCAAGCACACAGAGGGCGG + Intronic
1032508836 7:132455879-132455901 CCTCCCAGGCCTCCAGAGGTGGG - Intronic
1032530097 7:132613117-132613139 CCTCTCACGCACACAAAGGTTGG + Intronic
1034235086 7:149560480-149560502 ACACCCAGGCACACACACCTGGG - Intergenic
1034898141 7:154890662-154890684 CCACCCAGGGACACACATGTGGG + Intronic
1035353269 7:158261397-158261419 CCTGCCAGGATCACACAGTTGGG - Intronic
1036825755 8:11974627-11974649 CCTCCCAGGCAGACACCACTGGG - Intergenic
1037589561 8:20301792-20301814 CGACCCAGGCACACACAGCTGGG + Intronic
1037914024 8:22761129-22761151 CCTCCCCAGCAAGCACAGGTGGG + Intronic
1038515992 8:28188162-28188184 ACTCCCAGGCACAGACAGCCGGG + Intronic
1039903699 8:41770938-41770960 TCTCCCAGGCAGAGACAGCTTGG + Intronic
1041421936 8:57676751-57676773 CCTGCCAGGCACACAGACATGGG + Intergenic
1045391622 8:101720904-101720926 CATCCCCTGCACACACAGCTAGG - Intronic
1048200612 8:132371100-132371122 ACTCCCAGGCACAAAAAGATTGG + Intronic
1049185915 8:141253358-141253380 ATTCACAGGCACGCACAGGTGGG - Intronic
1049407405 8:142457852-142457874 CCTGCCAGGACCTCACAGGTGGG + Intronic
1049884628 9:18762-18784 CCTCCAGGGCACACAGAGGATGG + Intergenic
1052278310 9:26703794-26703816 GCTCCCAAGTACACACTGGTGGG + Intergenic
1052973739 9:34397519-34397541 CTTCCCAGGCACACAGGGGTGGG + Exonic
1053273876 9:36768914-36768936 ACTACCAGGCCCACACAGCTGGG + Intergenic
1053278756 9:36802840-36802862 GGTCCCAGGCACAAACATGTAGG - Intergenic
1054455957 9:65430516-65430538 CCTCCCTTGCACACAGAGGAGGG + Intergenic
1057747312 9:97762486-97762508 CTTCCCAGACTCACACAGGTGGG - Intergenic
1058121555 9:101144692-101144714 CCTAGCAGGCAAATACAGGTGGG + Intronic
1058907508 9:109493864-109493886 CCTCCCAGGTACAAGTAGGTGGG - Intronic
1060114062 9:120927178-120927200 CATCCCAAGCACACAGAGCTTGG - Exonic
1061134368 9:128724707-128724729 TCGCCCAGGGTCACACAGGTAGG - Intergenic
1061588373 9:131583056-131583078 CTTCCCAGGCACACACTGAGTGG + Intronic
1061877881 9:133554068-133554090 TCTTCCAGGCACGCCCAGGTGGG - Intronic
1061905711 9:133695885-133695907 CCCCCCATGCTCTCACAGGTGGG - Intronic
1062118592 9:134822144-134822166 CCTCCCAGATACACACCGGCAGG - Exonic
1062278848 9:135743110-135743132 CCTCCCAGGGACAGGCAGGCAGG + Intronic
1062407562 9:136404039-136404061 CCTCCCAGGCACTCACTTGATGG + Exonic
1062497260 9:136837700-136837722 ACCCCCAGGCCCTCACAGGTGGG + Intronic
1186511779 X:10135063-10135085 CCTCCCACTCATCCACAGGTTGG - Intronic
1193338630 X:80319985-80320007 CCTCCCAGACACATCCTGGTAGG + Intergenic
1193343714 X:80382393-80382415 CCTCCCAGACACACCCCAGTAGG - Intronic
1193916529 X:87371098-87371120 GGTCCCATGCACACACATGTTGG - Intergenic
1200401176 X:156021389-156021411 CCTCCAGGGCACACAGAGGATGG - Intergenic
1201177237 Y:11316403-11316425 CGGCCCAGGTACAAACAGGTGGG + Intergenic
1201759235 Y:17519203-17519225 GCTCCAAGGGACTCACAGGTGGG - Intergenic
1201842320 Y:18386787-18386809 GCTCCAAGGGACTCACAGGTGGG + Intergenic