ID: 911683462

View in Genome Browser
Species Human (GRCh38)
Location 1:100746092-100746114
Sequence TAGCCCTTGTCAATAACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911683458_911683462 30 Left 911683458 1:100746039-100746061 CCTTTTCATTTTCGAGTAAGATG No data
Right 911683462 1:100746092-100746114 TAGCCCTTGTCAATAACCCAGGG No data
911683459_911683462 -3 Left 911683459 1:100746072-100746094 CCTGAAGTTTTGCTGAGTCCTAG No data
Right 911683462 1:100746092-100746114 TAGCCCTTGTCAATAACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911683462 Original CRISPR TAGCCCTTGTCAATAACCCA GGG Intergenic
No off target data available for this crispr