ID: 911685194

View in Genome Browser
Species Human (GRCh38)
Location 1:100767713-100767735
Sequence CTGTGAGTATGCAGAGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911685192_911685194 19 Left 911685192 1:100767671-100767693 CCCAGTTAAGATGGCTATTATCA No data
Right 911685194 1:100767713-100767735 CTGTGAGTATGCAGAGAAAAAGG No data
911685193_911685194 18 Left 911685193 1:100767672-100767694 CCAGTTAAGATGGCTATTATCAA 0: 12
1: 176
2: 878
3: 2672
4: 6501
Right 911685194 1:100767713-100767735 CTGTGAGTATGCAGAGAAAAAGG No data
911685191_911685194 20 Left 911685191 1:100767670-100767692 CCCCAGTTAAGATGGCTATTATC No data
Right 911685194 1:100767713-100767735 CTGTGAGTATGCAGAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911685194 Original CRISPR CTGTGAGTATGCAGAGAAAA AGG Intergenic
No off target data available for this crispr