ID: 911686712

View in Genome Browser
Species Human (GRCh38)
Location 1:100785884-100785906
Sequence GGCCAGAACCATTCTGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911686708_911686712 -1 Left 911686708 1:100785862-100785884 CCTATGCACAGCTCCATGGATTG No data
Right 911686712 1:100785884-100785906 GGCCAGAACCATTCTGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911686712 Original CRISPR GGCCAGAACCATTCTGTGGT TGG Intergenic
No off target data available for this crispr