ID: 911688647

View in Genome Browser
Species Human (GRCh38)
Location 1:100806266-100806288
Sequence AACACTGTGCTTTAACCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911688646_911688647 -4 Left 911688646 1:100806247-100806269 CCACAAGCGCAGCTTCATGAACA No data
Right 911688647 1:100806266-100806288 AACACTGTGCTTTAACCAACAGG No data
911688645_911688647 -3 Left 911688645 1:100806246-100806268 CCCACAAGCGCAGCTTCATGAAC No data
Right 911688647 1:100806266-100806288 AACACTGTGCTTTAACCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911688647 Original CRISPR AACACTGTGCTTTAACCAAC AGG Intergenic
No off target data available for this crispr