ID: 911690710

View in Genome Browser
Species Human (GRCh38)
Location 1:100830732-100830754
Sequence CACCCCTCCCTGCTGCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911690706_911690710 21 Left 911690706 1:100830688-100830710 CCTAGCAATCATTAGCTATTTAA No data
Right 911690710 1:100830732-100830754 CACCCCTCCCTGCTGCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911690710 Original CRISPR CACCCCTCCCTGCTGCTGAC AGG Intergenic
No off target data available for this crispr