ID: 911693528

View in Genome Browser
Species Human (GRCh38)
Location 1:100862325-100862347
Sequence ACCAAAAATCTCTCCAGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911693527_911693528 -4 Left 911693527 1:100862306-100862328 CCACTACACAGTTATGAACACCA No data
Right 911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG No data
911693525_911693528 15 Left 911693525 1:100862287-100862309 CCAGATGCTAGTCACATTCCCAC No data
Right 911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG No data
911693523_911693528 19 Left 911693523 1:100862283-100862305 CCCACCAGATGCTAGTCACATTC No data
Right 911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG No data
911693524_911693528 18 Left 911693524 1:100862284-100862306 CCACCAGATGCTAGTCACATTCC No data
Right 911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG No data
911693526_911693528 -3 Left 911693526 1:100862305-100862327 CCCACTACACAGTTATGAACACC No data
Right 911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG No data
911693522_911693528 30 Left 911693522 1:100862272-100862294 CCTTCTCTCTACCCACCAGATGC No data
Right 911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911693528 Original CRISPR ACCAAAAATCTCTCCAGACG TGG Intergenic
No off target data available for this crispr