ID: 911693718

View in Genome Browser
Species Human (GRCh38)
Location 1:100863778-100863800
Sequence ACAGCTTGTGCTCCACACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911693718_911693729 28 Left 911693718 1:100863778-100863800 CCTGGGTGTGGAGCACAAGCTGT No data
Right 911693729 1:100863829-100863851 TTGGGAGGTCTGAGCTCATTAGG No data
911693718_911693726 9 Left 911693718 1:100863778-100863800 CCTGGGTGTGGAGCACAAGCTGT No data
Right 911693726 1:100863810-100863832 AGAGGGGAGGCTGGAGAGGTTGG No data
911693718_911693720 -9 Left 911693718 1:100863778-100863800 CCTGGGTGTGGAGCACAAGCTGT No data
Right 911693720 1:100863792-100863814 ACAAGCTGTATGGTTGTTAGAGG No data
911693718_911693724 0 Left 911693718 1:100863778-100863800 CCTGGGTGTGGAGCACAAGCTGT No data
Right 911693724 1:100863801-100863823 ATGGTTGTTAGAGGGGAGGCTGG No data
911693718_911693727 10 Left 911693718 1:100863778-100863800 CCTGGGTGTGGAGCACAAGCTGT No data
Right 911693727 1:100863811-100863833 GAGGGGAGGCTGGAGAGGTTGGG No data
911693718_911693723 -4 Left 911693718 1:100863778-100863800 CCTGGGTGTGGAGCACAAGCTGT No data
Right 911693723 1:100863797-100863819 CTGTATGGTTGTTAGAGGGGAGG No data
911693718_911693728 13 Left 911693718 1:100863778-100863800 CCTGGGTGTGGAGCACAAGCTGT No data
Right 911693728 1:100863814-100863836 GGGAGGCTGGAGAGGTTGGGAGG No data
911693718_911693721 -8 Left 911693718 1:100863778-100863800 CCTGGGTGTGGAGCACAAGCTGT No data
Right 911693721 1:100863793-100863815 CAAGCTGTATGGTTGTTAGAGGG No data
911693718_911693722 -7 Left 911693718 1:100863778-100863800 CCTGGGTGTGGAGCACAAGCTGT No data
Right 911693722 1:100863794-100863816 AAGCTGTATGGTTGTTAGAGGGG No data
911693718_911693725 5 Left 911693718 1:100863778-100863800 CCTGGGTGTGGAGCACAAGCTGT No data
Right 911693725 1:100863806-100863828 TGTTAGAGGGGAGGCTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911693718 Original CRISPR ACAGCTTGTGCTCCACACCC AGG (reversed) Intergenic
No off target data available for this crispr