ID: 911703834

View in Genome Browser
Species Human (GRCh38)
Location 1:100987624-100987646
Sequence TCCGAACATAAACTAGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911703834 Original CRISPR TCCGAACATAAACTAGATGA TGG (reversed) Intergenic
907561628 1:55395744-55395766 TCCCAAGATAACCTAGATGTTGG - Intergenic
911703834 1:100987624-100987646 TCCGAACATAAACTAGATGATGG - Intergenic
917017108 1:170545109-170545131 TCCAAACATTAAATAGCTGAGGG - Intronic
919137200 1:193525053-193525075 CCTCAACATAAACTAGATAAAGG + Intergenic
923220065 1:231884777-231884799 TCCGAACCTAAAATAAAAGATGG + Intronic
1069952168 10:72026610-72026632 TCTGCACATAGACAAGATGAGGG - Intergenic
1074129630 10:110562568-110562590 CCCGTACATAAACTGGATGAGGG - Intergenic
1080749165 11:35136934-35136956 TCTGAACATAGATCAGATGAAGG - Intergenic
1086532686 11:87804298-87804320 TCCTAGCATTAACTAGATCAAGG + Intergenic
1087445404 11:98244662-98244684 TTAGAATATAAACTTGATGAGGG + Intergenic
1095822151 12:46489974-46489996 TCAAAAAATAAACTGGATGATGG + Intergenic
1104670527 12:130677031-130677053 TCAGAACATAGTCTAGATTAGGG + Intronic
1109391498 13:61700566-61700588 TTCGAACATAACCGAGATTAAGG - Intergenic
1117120408 14:52562068-52562090 TTCTAACATAAATTAGATGATGG - Intronic
1117139239 14:52769751-52769773 TCCGGACCTGAACTAGATTAAGG - Intronic
1118153043 14:63210345-63210367 TTTGAACATAATGTAGATGAAGG - Intronic
1120458338 14:84760461-84760483 TCTGAGTATAAACTAGAAGAGGG - Intergenic
1125150757 15:36529670-36529692 TCAGAACATAATCTGGAAGAGGG + Intergenic
1128681723 15:69657357-69657379 TCTGAAGATAAACTGGAAGACGG - Intergenic
1138704448 16:58900093-58900115 TCAGAATATAAACTTCATGAAGG - Intergenic
1143694686 17:8603931-8603953 TCCAAACAAAAACTAGAAGTAGG + Intronic
1146094564 17:29916688-29916710 TCCTAACATAAACCTTATGAGGG - Intronic
1147527995 17:41245176-41245198 TCCCATCAAAAACTGGATGAAGG + Intronic
1150925682 17:69529318-69529340 TCTAAACAGAAACTAGTTGATGG - Intronic
1154330851 18:13428091-13428113 TTAGAGCATAAACTACATGAGGG - Intronic
1154974469 18:21443539-21443561 TCTGAAAATAAACTTGATCAGGG + Intronic
1159021845 18:63149764-63149786 TCCAAACAAAAACTAGAGAAAGG - Intronic
1164129449 19:22348661-22348683 TGGGAACATTAACTAGATTAAGG + Intergenic
1164170098 19:22717330-22717352 TGGGAACATTAACTAGATTAAGG - Intergenic
1166352718 19:42207722-42207744 TCCTAATAAAAACTGGATGAAGG + Intronic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927375842 2:22412566-22412588 TTTGACTATAAACTAGATGAGGG + Intergenic
928682975 2:33721587-33721609 GCAGAACATAATTTAGATGAGGG - Intergenic
930405127 2:50945035-50945057 TCAGACCATGATCTAGATGAGGG + Intronic
931852732 2:66269169-66269191 TGCGAACATAATCAATATGATGG - Intergenic
933444295 2:82358257-82358279 CCACAACATAAACTAGTTGAAGG - Intergenic
934064319 2:88326142-88326164 TCATAACATAAAGGAGATGATGG + Intergenic
935807834 2:106766563-106766585 TCAGAACAGGAACTAGAGGAAGG - Intergenic
940664325 2:156589030-156589052 TCCAACAATAAAATAGATGATGG - Intronic
941544455 2:166831067-166831089 TACAAACAAAAACTAAATGAAGG - Intergenic
942931350 2:181497070-181497092 TCCAATCAATAACTAGATGAAGG - Intronic
1174328023 20:49795102-49795124 TCAGATCATGAACTAGATTAGGG - Intergenic
1182568272 22:31215998-31216020 CCAGAACATACACTACATGAGGG - Intronic
956630340 3:71311012-71311034 TCAGAACATATACTCCATGAAGG + Intronic
956715404 3:72075488-72075510 TCTAAACATAAACTATGTGAGGG - Intergenic
957159695 3:76594644-76594666 TTAGAACGTAAACTAAATGAAGG + Intronic
960015181 3:112879270-112879292 TCTGAACCTAAAATAGAAGATGG - Intergenic
960790448 3:121424483-121424505 CCAGAAAATAAACTAGATGGTGG + Exonic
964960303 3:162414461-162414483 TCATAACATAAAATACATGAGGG + Intergenic
968046893 3:195629427-195629449 TCCTAAAATAAATTAGAAGAAGG - Intergenic
968307760 3:197660617-197660639 TCCTAAAATAAATTAGAAGAAGG + Intergenic
970559540 4:17269205-17269227 TCCCAACATCAAATAGTTGAAGG - Intergenic
973586634 4:52399167-52399189 TACAAACATAAACTTGATGTTGG - Intergenic
977476728 4:97519868-97519890 TCCTGAAATAAACTAGTTGAAGG + Intronic
978276122 4:106952461-106952483 TTCCAACTTAAACGAGATGAAGG + Intronic
980022521 4:127726856-127726878 TTGGAACATAAACTCCATGAGGG - Intergenic
984827342 4:183938312-183938334 TACTAACACAAACTGGATGATGG - Intronic
985744720 5:1639709-1639731 TCCTAAAATAAATTAGAAGAAGG + Intergenic
988980965 5:36568871-36568893 TTTGAACATAAACTAGTTAATGG + Intergenic
990343620 5:54849713-54849735 ACCGAACATAAACTCCATGAAGG + Intergenic
994608953 5:102011506-102011528 TCCTAACATAAAATAATTGATGG - Intergenic
996252170 5:121348777-121348799 TGAGAAGATAAAGTAGATGAAGG - Intergenic
996669828 5:126104364-126104386 TTAGCACATAAACTAGAAGATGG + Intergenic
999995850 5:157091535-157091557 TTGGAGCAGAAACTAGATGATGG + Intronic
1004311788 6:14552521-14552543 TACGTAAATAAACTATATGATGG + Intergenic
1012373498 6:98533469-98533491 TACGAACATAAACTAAGTGGGGG - Intergenic
1015366539 6:132402205-132402227 ACCAAACAAAAACTAGGTGAAGG - Intergenic
1016647977 6:146432519-146432541 TCCAAACAAAAACTAGAATATGG + Intronic
1023310024 7:38876883-38876905 TCCCAATATAAACTAAATGATGG - Intronic
1031121116 7:117723723-117723745 TTAGAATATAAACTCGATGACGG + Intronic
1042529607 8:69801651-69801673 TGCAAAAATAACCTAGATGATGG + Intronic
1044649205 8:94476632-94476654 TCAGAATATAAGCTACATGAGGG + Intergenic
1055168802 9:73229123-73229145 TCCGAACATAATCTAGTTTGAGG + Intergenic
1185829322 X:3284738-3284760 TCTGAACATAAAATAGAAGTTGG - Intergenic
1186026445 X:5318845-5318867 TCCAAAAATAAAATAGAAGAGGG - Intergenic
1187191495 X:17039505-17039527 TCTAAAACTAAACTAGATGATGG + Intronic
1196978611 X:121187072-121187094 CCAGAACATAACCTAAATGAGGG - Intergenic