ID: 911705590

View in Genome Browser
Species Human (GRCh38)
Location 1:101008609-101008631
Sequence CTAGACAGCCAAGGTTTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911705586_911705590 -4 Left 911705586 1:101008590-101008612 CCTCGTGTTAACTGACTCCCTAG No data
Right 911705590 1:101008609-101008631 CTAGACAGCCAAGGTTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911705590 Original CRISPR CTAGACAGCCAAGGTTTCTT TGG Intronic
No off target data available for this crispr