ID: 911706631

View in Genome Browser
Species Human (GRCh38)
Location 1:101021277-101021299
Sequence AATTATCAGCAGAAAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 22, 3: 231, 4: 476}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911706628_911706631 7 Left 911706628 1:101021247-101021269 CCTAGGACAAAAGAAGTCGAAGA No data
Right 911706631 1:101021277-101021299 AATTATCAGCAGAAAATGGCAGG 0: 1
1: 0
2: 22
3: 231
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911706631 Original CRISPR AATTATCAGCAGAAAATGGC AGG Intronic
900358570 1:2276610-2276632 ATTTGTAAACAGAAAATGGCAGG + Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
906050487 1:42867412-42867434 CATTATCTGCAGAAGATGGCAGG - Intergenic
906879674 1:49576460-49576482 AGTTATGTGCAGAAAATGGCAGG - Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910150303 1:84134354-84134376 AATTCTAGGCAGAAAAGGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG + Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911243999 1:95496706-95496728 TATTATCAGCAAAAAAGTGCTGG - Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911706631 1:101021277-101021299 AATTATCAGCAGAAAATGGCAGG + Intronic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
913097623 1:115534546-115534568 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
914828108 1:151150260-151150282 AAATATCAGTAGAAAAGGACAGG - Intergenic
915792856 1:158693945-158693967 CATATTCAACAGAAAATGGCAGG - Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918912881 1:190596194-190596216 AATTATCAGAAAAAAATTGAGGG + Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919221306 1:194632829-194632851 AATTATCAGCAATAAATGCAGGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
921044491 1:211464758-211464780 AGGTGTCAGCAGAAAATTGCTGG + Intergenic
921619818 1:217313135-217313157 AATTATCTGCAGACGATGGTAGG - Intergenic
921679970 1:218020109-218020131 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
921979111 1:221235859-221235881 GAGTATCAGCAGAAACTTGCAGG - Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
923698282 1:236276397-236276419 AATGATTAGCAGTCAATGGCAGG + Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063356900 10:5409633-5409655 AATTTTCATCAGAAAATGGCTGG - Intergenic
1063567845 10:7187480-7187502 GTTTATTTGCAGAAAATGGCAGG - Intronic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1066167029 10:32799232-32799254 GATTATCTGCAGAAGACGGCAGG + Intronic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1067364566 10:45613227-45613249 AATTATTAGAAGAAATTGGAGGG + Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069121028 10:64569221-64569243 AAATATCAACAGAAAATGGAGGG + Intergenic
1069388182 10:67903681-67903703 AACTATCCGCAGAAATTGGCCGG - Intronic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070189617 10:74099827-74099849 GATTCTCAGCATTAAATGGCAGG + Intronic
1070774195 10:79100298-79100320 AATGCTCAGCAGAAAGAGGCAGG + Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072360467 10:94654141-94654163 AATTGTCTACAGAAGATGGCAGG - Intergenic
1073568365 10:104555053-104555075 CATTTTGAGCAAAAAATGGCTGG - Intergenic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1074074210 10:110106402-110106424 AACTTTCAGGAGAAAGTGGCAGG - Intronic
1075606787 10:123817397-123817419 CATTATTTGCAGAAGATGGCAGG - Intronic
1076454865 10:130583951-130583973 GAAAATTAGCAGAAAATGGCTGG - Intergenic
1076625987 10:131822343-131822365 GGTCATCAGAAGAAAATGGCAGG + Intergenic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077778494 11:5298148-5298170 AATTTTAGGCAGAAAAGGGCGGG - Intronic
1079939114 11:26655914-26655936 AATTATTGGGAGAAAACGGCAGG + Intronic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080182665 11:29443250-29443272 TTTTAGCAGCAGAAATTGGCAGG - Intergenic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081168191 11:39832798-39832820 AATTATTAGTAAAATATGGCTGG + Intergenic
1081462636 11:43286110-43286132 AATAATTAGAAGAATATGGCAGG + Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082999658 11:59279854-59279876 TAGTATCTGCAGAAGATGGCAGG - Intergenic
1083064289 11:59907952-59907974 AATTACCAACAAAAAATGTCCGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1084920160 11:72462818-72462840 AATTATCAGCTGAAAAAAGGAGG - Intergenic
1085061838 11:73454523-73454545 AATTCTTAGCAGAAAAGAGCAGG + Intronic
1085382155 11:76129690-76129712 AAATAGCAGGAGAAATTGGCAGG - Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1085870832 11:80347344-80347366 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088269982 11:108024190-108024212 AATTATAGGCAGTAAGTGGCAGG - Intronic
1088715383 11:112544272-112544294 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090894728 11:130961270-130961292 AATTATCAACAAAAAATGTTCGG - Intergenic
1091033730 11:132214478-132214500 AGTTATAGGCATAAAATGGCAGG - Intronic
1091051736 11:132378728-132378750 AATTATTTGTAGAAGATGGCAGG - Intergenic
1091511967 12:1136336-1136358 AAAGATGAGCAGAAGATGGCTGG - Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092094048 12:5827470-5827492 AATTATCCGGATAAAGTGGCAGG + Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094819396 12:34212699-34212721 GGTTATCTGCAGATAATGGCAGG - Intergenic
1095048072 12:37532683-37532705 AGATGTCAGCAGAAAATGGCAGG - Intergenic
1095095414 12:38145375-38145397 GGTTATCTGCAGATAATGGCAGG + Intergenic
1095121508 12:38424871-38424893 AGTTTTCTGCAGAAAATGCCAGG + Intergenic
1095327475 12:40913285-40913307 TGTTATCAGCAGGAAATGGTTGG + Intronic
1095708030 12:45258950-45258972 AAGTATCTTCAGAAAATGGTGGG + Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096402970 12:51322894-51322916 ATTTATCAGCAGAAAACTGATGG - Intronic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097076998 12:56402414-56402436 AGTTATCGCCAGAAGATGGCAGG - Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098433753 12:70447969-70447991 AATACTCAACAGAAAATGGTGGG - Intergenic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1098936837 12:76490226-76490248 AATTCTAGGCAGAAAACGGCAGG + Intronic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099540828 12:83905155-83905177 AATTGTAGGCAGAAAAGGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099713216 12:86256023-86256045 AATTTGCAGCAGAAAATGAAAGG - Intronic
1099773299 12:87092576-87092598 GAGGATCAGCAGGAAATGGCTGG - Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100293007 12:93235436-93235458 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
1100757988 12:97773361-97773383 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1101210148 12:102527261-102527283 AATTTTCAGCAAGAAAGGGCTGG + Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101493807 12:105235514-105235536 AGTTGTCAGCAGACAATGTCCGG - Intronic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103424630 12:120822378-120822400 TATTATCAGCATTAAATGGCAGG - Intronic
1104256517 12:127143764-127143786 AATTAACACCAGAAAAGGGGAGG - Intergenic
1104265780 12:127231445-127231467 AATTCTGGGCAGAAAAGGGCAGG + Intergenic
1105033330 12:132900520-132900542 AATTATCTGCAGACAATGTCAGG + Intronic
1105276647 13:18934899-18934921 AATCATCAACATAAAAAGGCAGG + Intergenic
1105652067 13:22389885-22389907 GACTAGCAGAAGAAAATGGCAGG - Intergenic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1106870231 13:34011447-34011469 AAGAATCAGCCGAATATGGCCGG + Intergenic
1107041442 13:35952357-35952379 AATTAGCATCAGAGAATGGGTGG + Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108398496 13:50014027-50014049 ACTTATCACAAGAAAATGCCAGG - Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1108914305 13:55588898-55588920 ACTTATCTGCAGGAGATGGCAGG + Intergenic
1109277449 13:60318388-60318410 TATTAACAGCAGAGAGTGGCTGG + Intergenic
1109293221 13:60500091-60500113 AGTTATCCACAGAAGATGGCAGG - Intronic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110356326 13:74571929-74571951 AATTTTCTGCAGAGAATGCCAGG - Intergenic
1110680618 13:78307968-78307990 AACTATGAACAGAAAATGGAAGG + Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1111115647 13:83773385-83773407 AATAATAAACAGTAAATGGCCGG - Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111606474 13:90546061-90546083 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1111720986 13:91944885-91944907 AGTTAACACCAGAAAATGGGGGG - Intronic
1111820007 13:93201624-93201646 TATTATCAGAAGAAAATGACAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1113108087 13:106792586-106792608 AATTCACAGCAGAAAGTGGAAGG + Intergenic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1113370997 13:109725431-109725453 AATTATCAGCTGAAAGAGGAAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115712735 14:36068694-36068716 AATTATCAGAGAAAAATGGAGGG - Intergenic
1115903487 14:38180842-38180864 AATTCTCATCAGAAAAATGCAGG + Intergenic
1115924435 14:38414790-38414812 AATGATAAGCAGAAAAAAGCAGG + Intergenic
1116058905 14:39896911-39896933 AGTTATCTGTAGAATATGGCAGG - Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118266195 14:64296815-64296837 AATAATAAGCAGAAAATGAATGG + Intronic
1118408570 14:65452005-65452027 AATTCTAGGCAGAAAATGGTGGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1120250743 14:82059676-82059698 AATTATCTGCAAATGATGGCAGG + Intergenic
1120282928 14:82462393-82462415 AATTATCACCATGAAATGACAGG + Intergenic
1120435500 14:84476404-84476426 AAATTTCAGCAGAAAATTGTAGG - Intergenic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1120990222 14:90369209-90369231 TATTATCAGCAGCATGTGGCTGG + Intergenic
1123116026 14:105894474-105894496 AACTAGCAGCAAAAACTGGCCGG - Intergenic
1123679717 15:22752937-22752959 AGTTAACACCAGAAAATGGGGGG - Intergenic
1124331936 15:28827415-28827437 AGTTAACACCAGAAAATGGGGGG - Intergenic
1125713238 15:41804134-41804156 AAAAATAAGCAGAAAGTGGCCGG - Intronic
1125959969 15:43821579-43821601 AAAAATCAGTAGAAAATGGATGG + Intronic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1126452932 15:48829546-48829568 AATGATAACCAAAAAATGGCAGG - Intronic
1126898839 15:53290146-53290168 AGTTAGCAGCAGAGAATGTCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1128346876 15:66859530-66859552 AAATATTAACAGACAATGGCCGG - Intergenic
1130245526 15:82244664-82244686 TATTAGCAGCAGAAATTGTCTGG - Intronic
1130455171 15:84098702-84098724 TATTAGCAGCAGAAATTGTCTGG + Intergenic
1131614892 15:94005818-94005840 ATTTAACAGCAGAAAATGGTAGG - Intergenic
1131648715 15:94375434-94375456 AATTATCAGGAGGCAATGGAGGG + Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1134153471 16:11823326-11823348 AATAAAAAGAAGAAAATGGCTGG + Intergenic
1135357502 16:21781784-21781806 CAATATCATAAGAAAATGGCTGG - Intergenic
1135456006 16:22597900-22597922 CAATATCATAAGAAAATGGCTGG - Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1136361339 16:29781898-29781920 GAGAATCAGCAGACAATGGCAGG + Exonic
1137377098 16:47961561-47961583 AGTCATGAGCAGAAAATGGAGGG + Intergenic
1138005973 16:53338134-53338156 AATTTTCAGAAGAAAGGGGCAGG + Intergenic
1138463435 16:57168216-57168238 AATTATCAGCCCAAAAAGGTGGG + Intronic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1140786545 16:78347755-78347777 AATTATAATCAGAAATTGCCAGG - Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1142739089 17:1920166-1920188 AATTATCTGCAAATAATGGAAGG + Intergenic
1145411337 17:22668869-22668891 AGATGTCAGCAGAAAATGGCCGG - Intergenic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1148537716 17:48454840-48454862 AATTCTCGGCAGAAAAGGGCAGG + Intergenic
1149237233 17:54606877-54606899 AATTATAGGCAAAAAAGGGCAGG + Intergenic
1150619205 17:66796710-66796732 AAATAACAGCAGAAATGGGCTGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1152998623 18:432295-432317 TATTATCATCAGCAAATAGCAGG + Intronic
1153028024 18:688741-688763 AATTAACAGCAGAAACAGCCTGG + Intronic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1154960776 18:21306324-21306346 AATTATCATGAAAAATTGGCAGG - Intronic
1155657565 18:28209695-28209717 ACTTATTAGCAGAAAAAGGTGGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1156651728 18:39233873-39233895 AATTCTCGGCAGACAGTGGCAGG - Intergenic
1156814253 18:41290352-41290374 AAAAATCAACAGAAGATGGCCGG + Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159545699 18:69838299-69838321 ATTTATCAGCATAAGATAGCTGG - Intronic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1161656489 19:5518804-5518826 AAATTTTAGTAGAAAATGGCAGG + Intergenic
1162768639 19:12935903-12935925 AATAATCAACATAAAATGGGAGG - Intergenic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164237523 19:23350124-23350146 ACTTATTAGCAGAAAAAGGTGGG + Intronic
1164905635 19:31965329-31965351 AATAAACAGCAGAAAACAGCCGG - Intergenic
1166497728 19:43316358-43316380 AATTTTGGCCAGAAAATGGCAGG + Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925499410 2:4486952-4486974 AATAATCTGCAGAAAATGGCAGG + Intergenic
925652989 2:6111951-6111973 AGTAAGCAGCAGAAACTGGCAGG + Intergenic
925656867 2:6158480-6158502 CCTTAGCAGCAGAAAAAGGCAGG - Intergenic
926329779 2:11814845-11814867 AATCCTCAGGAGAACATGGCTGG - Intronic
926810399 2:16750706-16750728 TAGTATCTGCAGAAGATGGCAGG + Intergenic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
929478107 2:42273924-42273946 AATTATAACCAGAAAATAACTGG + Intronic
930074501 2:47395673-47395695 AATTATCACCCCAACATGGCTGG - Intergenic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930527221 2:52545328-52545350 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
931567200 2:63627408-63627430 AATTCTAGGCAGAAAAGGGCGGG + Intronic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
934867869 2:97829540-97829562 ACGAATCAGCAGAACATGGCGGG + Intronic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935679006 2:105620078-105620100 AACTATCAGCAGAACCTGGACGG - Intergenic
936464434 2:112734656-112734678 GATTGTCAGCAGGAAATGGGTGG + Intronic
936646294 2:114376411-114376433 AATTATCTGTGGATAATGGCAGG + Intergenic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
937800324 2:126074699-126074721 ACTTATCTGAAGAAGATGGCAGG - Intergenic
937840342 2:126518741-126518763 AATTCTAGGCAGAAAAAGGCAGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939087164 2:137735257-137735279 ATTTTTCAGCAGAAACTTGCAGG - Intergenic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940432774 2:153612769-153612791 TATTATCAAAAGAAAAAGGCAGG + Intergenic
941085063 2:161107898-161107920 AATTATAAATAGAAAATTGCTGG + Intergenic
941207365 2:162590632-162590654 AATTATCAGCACAAAGTCCCTGG + Intronic
941577167 2:167247783-167247805 AATGACCACCAGAAAATGGAGGG + Exonic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941691773 2:168507550-168507572 GATTATCACCACCAAATGGCAGG - Intronic
942321943 2:174743517-174743539 ACTTATCTGCAGATGATGGCAGG - Intergenic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943049545 2:182898675-182898697 AATTTTCAGGAGAAAATGTAGGG + Intergenic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
944067455 2:195633951-195633973 AATTCTAGGCAGAAAAGGGCAGG - Intronic
944199443 2:197090585-197090607 AATTCTAGGCAGAAAAGGGCAGG + Intronic
944416040 2:199480795-199480817 AGTTATCAGAAGAGAATGCCTGG - Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945642175 2:212443808-212443830 ACTTATCTGCAGAACATGGCAGG - Intronic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946532328 2:220584543-220584565 AATAAATAGCAGAAAATGGGGGG + Intergenic
946703777 2:222437821-222437843 AGTTATCTGCAGAAAATGGTAGG + Intronic
947128378 2:226895649-226895671 AATCTTCAGAACAAAATGGCAGG - Intronic
947346247 2:229192070-229192092 AATTATTAGAAGAAAATAGGGGG + Intronic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
947622581 2:231600277-231600299 GATTAACAGGAGAAAAGGGCTGG - Intergenic
948948505 2:241234122-241234144 CATTATTAGCAGATAATGGAAGG - Intronic
1169292023 20:4361022-4361044 AATTATTAACATTAAATGGCTGG + Intergenic
1169674499 20:8138376-8138398 AATCGCCAGCAGAAAATGGAAGG + Intronic
1170008729 20:11697411-11697433 AGTTATCAGCAGCCAATGACTGG - Intergenic
1171542616 20:25976153-25976175 AGATGTCAGCAGAAAATGGCAGG - Intergenic
1171798444 20:29584370-29584392 AGATGTCAGCAGAAAATGGCAGG + Intergenic
1171845651 20:30272803-30272825 AGATGTCAGCAGAAAATGGCAGG - Intergenic
1174884708 20:54320768-54320790 TCTTATCAGCAGGAAATGGAGGG + Intergenic
1174975882 20:55333220-55333242 AATTATTAGGAGAATATGGAAGG - Intergenic
1175037796 20:56016732-56016754 TTTTATCAGCTGAAAATGCCAGG - Intergenic
1175356733 20:58374758-58374780 CTTTCTCAGCACAAAATGGCAGG + Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176870521 21:14080129-14080151 GGTTATCTGCAGATAATGGCAGG - Intergenic
1176899319 21:14420306-14420328 AATAATCAGCAGAAAGTCCCAGG + Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178266480 21:31147053-31147075 AAATATCAGCAGGTTATGGCAGG + Intronic
1178634463 21:34290168-34290190 AATTACCTTCAGATAATGGCAGG - Intergenic
1178713123 21:34937811-34937833 GATTTTCAACAGAAAATGCCAGG + Intronic
1178957765 21:37039034-37039056 AATTATTAGCACACAATTGCAGG + Intergenic
1179382154 21:40909916-40909938 AATTATCTACAGCAAATGACAGG + Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181993221 22:26854115-26854137 ACTTATGAGCAGGAAAGGGCAGG + Intergenic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
1184832557 22:46998314-46998336 AACTATCAGGAGAATATGCCTGG - Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
949665704 3:6337098-6337120 TATTATAAGCAGAAAATAACAGG - Intergenic
950997410 3:17518156-17518178 AATTCTAAGCAGAAAAGGGTGGG + Intronic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951229194 3:20157293-20157315 TGTTAACAGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951933151 3:27992699-27992721 GATTTCCAGCACAAAATGGCTGG + Intergenic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
952716141 3:36482933-36482955 ACTAATCAGCAGGAAATGGCAGG + Intronic
953321489 3:41976365-41976387 AATTATCCGCAGAGAATGAGGGG + Intergenic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
955661144 3:61300421-61300443 AATTAACAGAAGAAAAGGGTAGG + Intergenic
956201328 3:66709359-66709381 GATTATTAGCAGAAAATGACAGG + Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960349526 3:116575671-116575693 AGTTATCTTCAGAAAATGGCAGG - Intronic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
963258074 3:143166147-143166169 AATTTTTAGCAGAAAATGCTTGG - Intergenic
963410618 3:144922389-144922411 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
964098161 3:152957604-152957626 AATTATTAGCTGCAAATGGGAGG + Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
964740738 3:159962856-159962878 AATGATCTGCCTAAAATGGCAGG + Intergenic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966345709 3:178977284-178977306 AATTACCACCTGAAAATGCCTGG - Intergenic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
970131599 4:12877152-12877174 AATTCTAGGCAGAAAAAGGCAGG - Intergenic
970289941 4:14561178-14561200 TTTTAGCAGCAGAAAAAGGCAGG + Intergenic
970444896 4:16115380-16115402 AATCATCATCTGAATATGGCGGG + Intergenic
970530811 4:16981138-16981160 AATGCTCAGGAGAAAATGGCTGG - Intergenic
970941614 4:21640944-21640966 AGTTATCTGCAGAGAGTGGCAGG - Intronic
971019387 4:22518225-22518247 ATATAGCAGCAGAAAAGGGCTGG - Intergenic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973764036 4:54147803-54147825 AATTATCAATAGAAAATGGCAGG - Intronic
974158225 4:58102380-58102402 AAAAAACAGCAGAAAGTGGCTGG - Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974644619 4:64674794-64674816 AATTATCTGCAGGAAATGGCAGG + Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
975485112 4:74927155-74927177 AAATACAAGGAGAAAATGGCTGG - Intergenic
975665397 4:76729988-76730010 AATTTTCAGCATGAAATGCCTGG + Intronic
975947430 4:79724320-79724342 AATTCTATGCAGAAAAGGGCGGG - Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976287633 4:83385431-83385453 ATTTCTCCCCAGAAAATGGCTGG + Intergenic
976954025 4:90871985-90872007 AATGAAAAGCAGAAAATGGCAGG - Intronic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977781396 4:100985703-100985725 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978513117 4:109543116-109543138 AATTATCCCCAAAAAATGACAGG + Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978872939 4:113602574-113602596 AATTAATGGCAGATAATGGCTGG - Intronic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979184315 4:117770130-117770152 AATTCTAAGCAGAAAAGGGCAGG + Intergenic
979551543 4:121996760-121996782 AATCATCAGTAGAACAAGGCAGG - Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
981646973 4:147009923-147009945 ATTTCACAGCAGAAAAAGGCAGG - Intergenic
981963124 4:150565629-150565651 AATTGTCAGCTGAAATTGCCAGG - Intronic
982070750 4:151692482-151692504 AATCAGAAGGAGAAAATGGCAGG + Intronic
982354484 4:154451268-154451290 AGTTGTCTGCAGAGAATGGCAGG - Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983339033 4:166434439-166434461 AGTTATCTGCAGAGAATGGAAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984987568 4:185346153-185346175 AGTTAACAATAGAAAATGGCCGG - Intronic
986087107 5:4462688-4462710 ATTTATCTGCAGAAGATAGCAGG - Intergenic
986390684 5:7284741-7284763 AGTTAACACCAGAAAATGGGGGG - Intergenic
986422771 5:7600793-7600815 ATAGATTAGCAGAAAATGGCAGG + Intronic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987577066 5:19743575-19743597 AAAGATCTGCAGACAATGGCAGG - Intronic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988158462 5:27486742-27486764 GATTATAAGAAGAAAATGTCAGG - Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
988715425 5:33822554-33822576 ACTTATCACCTGCAAATGGCTGG + Intronic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
988777230 5:34488430-34488452 ATTTATCATCAGAAATTGTCGGG + Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989437445 5:41431532-41431554 AATTATCAGCATGAATTGGGAGG + Intronic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991038059 5:62147910-62147932 AATTATAAGCACAAAATCGAAGG - Intergenic
991485443 5:67130556-67130578 AATTATCAGAAGATAATGACTGG - Intronic
991554367 5:67878703-67878725 TAGTAACAACAGAAAATGGCAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
992271502 5:75068883-75068905 AAACATCAGCAGAAAAAGGATGG + Intronic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
993841182 5:92880935-92880957 ACTGATAACCAGAAAATGGCTGG - Intergenic
994141759 5:96348914-96348936 AATTATGAGCAGAAAGTGCAAGG + Intergenic
994145624 5:96391877-96391899 AATCAGAAGCAGAAACTGGCAGG - Exonic
994291377 5:98032000-98032022 AGTTATCCACAGAAGATGGCAGG + Intergenic
994830479 5:104775222-104775244 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
995874963 5:116780827-116780849 AATTAACAGGAGAAACTGCCTGG + Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
996884202 5:128336787-128336809 AGATAACAGAAGAAAATGGCAGG + Intronic
999564403 5:152841312-152841334 CAATATGAGCATAAAATGGCAGG + Intergenic
999868149 5:155724129-155724151 AATTTTAAGCAAAAACTGGCAGG - Intergenic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002989293 6:2223251-2223273 AACTATCCGTACAAAATGGCTGG + Intronic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003273396 6:4626829-4626851 AAATATCAAAAGAAAAGGGCAGG + Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1003743587 6:8972314-8972336 AATTTGCAGTAGAAAATGGGTGG + Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005586431 6:27280661-27280683 AATTACCACAAGAAAATAGCCGG + Intergenic
1005657441 6:27955752-27955774 AGTTCTCAGTATAAAATGGCAGG - Intergenic
1005929051 6:30467149-30467171 AATCTTCAGCAGAAAATGGAAGG + Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006704461 6:36006585-36006607 AAATATAAGTAGAAACTGGCAGG + Intronic
1007488523 6:42199409-42199431 ATGTATCTTCAGAAAATGGCAGG + Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008780380 6:55096052-55096074 AATTATGAACAGAAAATATCTGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009459955 6:63900679-63900701 ATCCATCAGCAGAAAATGGAAGG + Intronic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010431699 6:75784824-75784846 AAGTATCAGCTGAAGATTGCGGG + Intronic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011733521 6:90290760-90290782 AAGTATCTGCAGAAAGTGACAGG + Intronic
1011812040 6:91144037-91144059 AGTTATCAGCAGAAAACAGCTGG + Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012378535 6:98591301-98591323 AATAAATAGCAGAAAATTGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1014383309 6:120771233-120771255 AATCATCAAAAGAAAAGGGCTGG - Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1014857560 6:126420589-126420611 AATTATCTGCAGATATTTGCTGG + Intergenic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015466851 6:133557745-133557767 AGTTATCAGCAGAAGACGGCAGG + Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015764791 6:136704880-136704902 AATTATATGCAGAAAAAGACAGG + Intronic
1016130830 6:140467465-140467487 ATTTATGACCAGAAAATGACTGG + Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016576261 6:145572615-145572637 AGTTATCTGCAGAAAACGGCAGG + Intronic
1017016032 6:150100192-150100214 ACTTATCAGCAGAAGAAGGTGGG + Intergenic
1017248531 6:152254544-152254566 AAGAATATGCAGAAAATGGCCGG - Intronic
1017584804 6:155909063-155909085 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020121669 7:5507537-5507559 AATAATTAGCAGAACAAGGCCGG + Intronic
1020246917 7:6436648-6436670 AATTATAAGTAGAAAAAGTCAGG - Intronic
1020382514 7:7562505-7562527 AATTATAAGCAAAACAGGGCTGG - Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021289100 7:18821647-18821669 AATTATCTGCAGACACTGACTGG + Intronic
1021711311 7:23418398-23418420 AAGTAACAGCACAAAATAGCAGG + Intronic
1021935346 7:25625341-25625363 AATTAAAAGCAGAAAATTGGAGG - Intergenic
1022539575 7:31123440-31123462 AATTGTCTGCAGAAGAGGGCAGG - Intergenic
1023219991 7:37911341-37911363 CATTAACAGCAGAGAATGGGAGG + Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024808914 7:53184281-53184303 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
1025293988 7:57761253-57761275 AGATGTCAGCTGAAAATGGCAGG - Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1027647069 7:80814993-80815015 AATCTTCAGCAGAAAATGGCAGG - Intronic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1028043857 7:86091437-86091459 AGTTATCTGCAGAAAAGGGCTGG - Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028669385 7:93383786-93383808 TACCATCAGCAGAAAATGGTGGG + Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1030266573 7:107628363-107628385 AATTGTCGGCAGAAAAAAGCAGG + Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1031116336 7:117673038-117673060 AATTCTAGGCAGAAAAGGGCGGG + Intronic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032248426 7:130232432-130232454 AATTCTGGGCAGAAAAGGGCAGG - Intergenic
1032797591 7:135290207-135290229 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
1033431179 7:141291046-141291068 AATTGTCAGCAGGACAAGGCAGG + Intronic
1035495057 7:159317451-159317473 ATTTATGGGCAGAAAATGGAAGG - Intergenic
1035791395 8:2308733-2308755 AATTCTCAGCAGATAATGAATGG + Intergenic
1035801410 8:2412972-2412994 AATTCTCAGCAGATAATGAATGG - Intergenic
1036920774 8:12852525-12852547 AAATGTCACCAGAAAATTGCAGG - Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1037551712 8:19980240-19980262 AATTATCAGCAGAAAACTTAAGG + Intergenic
1038449733 8:27632491-27632513 ACATATATGCAGAAAATGGCAGG - Intergenic
1039090356 8:33821524-33821546 AATGATAAGCACAAAATGACAGG - Intergenic
1039222309 8:35346489-35346511 AATTGTCAAAAGAAAATGGAGGG + Intronic
1039398312 8:37246606-37246628 ATTTATCAGCTAATAATGGCTGG + Intergenic
1039679129 8:39709528-39709550 AATTTTAGGCAGAAAAAGGCAGG - Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041573149 8:59360720-59360742 ACTTATAAGCAGCAAATGGTAGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042356044 8:67828819-67828841 AACTATAAGCAGAAAATGACAGG - Intergenic
1042477129 8:69260875-69260897 AATTATAAGCAAAAAATTGGGGG + Intergenic
1043019118 8:74979120-74979142 AAGTACCAGAAAAAAATGGCTGG + Intergenic
1044090763 8:87997017-87997039 AGAAATCAGCAGAAATTGGCTGG - Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046505069 8:115126490-115126512 AATTGTCAGTGGAAAATAGCAGG - Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1048384624 8:133900556-133900578 ATTTTTCAGCAGAAAACAGCTGG + Intergenic
1049264767 8:141661688-141661710 CTTTACCAGAAGAAAATGGCTGG - Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052593706 9:30531561-30531583 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1052649080 9:31276403-31276425 ATTTATCAGCAGATAAAGACAGG + Intergenic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1054162426 9:61683043-61683065 AGATGTCAGCAGAAAATGGCAGG + Intergenic
1055129740 9:72761477-72761499 GATAATCAGCAGAAAAGGGGAGG - Intronic
1055240831 9:74183700-74183722 AGTTCTCAGCAGAAGAGGGCAGG - Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1055923205 9:81483507-81483529 AATTATAAGCTGAAAAAGCCAGG - Intergenic
1056126619 9:83540926-83540948 AATTATCAGCAGGAAAGAGTGGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056241169 9:84647895-84647917 AGTTATCAGCAGATTATGGTAGG + Intergenic
1056314237 9:85372975-85372997 AATTATCTGCTGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056394621 9:86170186-86170208 AAAAATCAGCAGAAGATGCCGGG - Intergenic
1056793940 9:89644001-89644023 AATTGTCAGAAGAAAATGAAGGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1059002725 9:110366983-110367005 AATTATCTGGAGAAAAGGCCAGG + Intronic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1059204941 9:112455749-112455771 AATTATCTGCTGACACTGGCAGG - Intronic
1060013143 9:120062363-120062385 AATTATCATAAGAACATGCCTGG + Intergenic
1060288503 9:122277154-122277176 AATTAAAAGAAGAAACTGGCTGG - Intronic
1060551106 9:124485878-124485900 AATTGTCAGAAGAGAATGTCAGG - Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1186734957 X:12452457-12452479 CATAATCAGCAGAAAACAGCTGG + Intronic
1186809610 X:13175224-13175246 AATTGGCAACAGAAAATGTCTGG + Intergenic
1186954119 X:14661573-14661595 ATTTAAAAGTAGAAAATGGCTGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1190183019 X:48209435-48209457 AATGATCAGAGGAAAATAGCAGG - Intronic
1190255269 X:48757773-48757795 AGTTATCTGCAGAGAATAGCAGG - Intergenic
1190601542 X:52097865-52097887 AATTATCTGAGGATAATGGCAGG + Intergenic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193809926 X:86039595-86039617 AATTCTAGGCAGAAAAGGGCAGG + Intronic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194011469 X:88567542-88567564 ACTGTGCAGCAGAAAATGGCAGG + Intergenic
1194176257 X:90651714-90651736 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194649419 X:96497840-96497862 AGTTATCTGTAGATAATGGCAGG - Intergenic
1194754452 X:97721347-97721369 AAATTTCACCAGAAAATGTCTGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1194903749 X:99547681-99547703 AATGAATGGCAGAAAATGGCCGG + Intergenic
1195973616 X:110500919-110500941 AATAATCACAAGAACATGGCAGG - Intergenic
1196122558 X:112066470-112066492 AAATATCAACAGAACATGGTAGG + Intronic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197021414 X:121694329-121694351 AAATATAAATAGAAAATGGCAGG - Intergenic
1197044411 X:121978294-121978316 AGTTACCTGCAGAATATGGCAGG - Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198169813 X:134094639-134094661 TGTTATAAGCAGAAAATGTCTGG + Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199219947 X:145306252-145306274 AATTCTAGGCAGAAAATGGTGGG - Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200522882 Y:4232659-4232681 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200973127 Y:9177742-9177764 ATTTATCTACAGAAGATGGCAGG + Intergenic
1201765801 Y:17572653-17572675 GGTTATCTGCAGATAATGGCAGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1201835751 Y:18333336-18333358 GGTTATCTGCAGATAATGGCAGG + Intergenic
1201905517 Y:19082545-19082567 AATGCTCATCAGAAAATGACTGG + Intergenic
1202177213 Y:22108819-22108841 AGTTGTCAGCAAAAGATGGCCGG + Intergenic
1202214148 Y:22477565-22477587 AGTTGTCAGCAAAAGATGGCCGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202388774 Y:24349098-24349120 AAATATTAGCAGGATATGGCTGG + Intergenic
1202482013 Y:25321027-25321049 AAATATTAGCAGGATATGGCTGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic