ID: 911709836 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:101057827-101057849 |
| Sequence | CAGAATGCAAAGAGGCAGCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 911709836_911709840 | 17 | Left | 911709836 | 1:101057827-101057849 | CCTTGCTGCCTCTTTGCATTCTG | No data | ||
| Right | 911709840 | 1:101057867-101057889 | CTGAGGACTTCCTAGCCATGTGG | No data | ||||
| 911709836_911709839 | 0 | Left | 911709836 | 1:101057827-101057849 | CCTTGCTGCCTCTTTGCATTCTG | No data | ||
| Right | 911709839 | 1:101057850-101057872 | CCATGATTCTAAGTTTGCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 911709836 | Original CRISPR | CAGAATGCAAAGAGGCAGCA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||