ID: 911709836

View in Genome Browser
Species Human (GRCh38)
Location 1:101057827-101057849
Sequence CAGAATGCAAAGAGGCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911709836_911709840 17 Left 911709836 1:101057827-101057849 CCTTGCTGCCTCTTTGCATTCTG No data
Right 911709840 1:101057867-101057889 CTGAGGACTTCCTAGCCATGTGG No data
911709836_911709839 0 Left 911709836 1:101057827-101057849 CCTTGCTGCCTCTTTGCATTCTG No data
Right 911709839 1:101057850-101057872 CCATGATTCTAAGTTTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911709836 Original CRISPR CAGAATGCAAAGAGGCAGCA AGG (reversed) Intergenic
No off target data available for this crispr