ID: 911711289

View in Genome Browser
Species Human (GRCh38)
Location 1:101076652-101076674
Sequence CTAAAACAACTGTAGATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911711286_911711289 14 Left 911711286 1:101076615-101076637 CCTCACTTTGATGAGACAAACTT No data
Right 911711289 1:101076652-101076674 CTAAAACAACTGTAGATCCAGGG No data
911711285_911711289 30 Left 911711285 1:101076599-101076621 CCTATAGAAGTCTTGGCCTCACT No data
Right 911711289 1:101076652-101076674 CTAAAACAACTGTAGATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911711289 Original CRISPR CTAAAACAACTGTAGATCCA GGG Intergenic
No off target data available for this crispr