ID: 911715035

View in Genome Browser
Species Human (GRCh38)
Location 1:101123260-101123282
Sequence CATCCAGTTCATTCTCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911715032_911715035 -5 Left 911715032 1:101123242-101123264 CCGCAGCCACTCTGGCCTCATCC No data
Right 911715035 1:101123260-101123282 CATCCAGTTCATTCTCCTTGTGG No data
911715028_911715035 21 Left 911715028 1:101123216-101123238 CCTGAAATTTTGTAATAGCCTCC No data
Right 911715035 1:101123260-101123282 CATCCAGTTCATTCTCCTTGTGG No data
911715031_911715035 0 Left 911715031 1:101123237-101123259 CCTGACCGCAGCCACTCTGGCCT No data
Right 911715035 1:101123260-101123282 CATCCAGTTCATTCTCCTTGTGG No data
911715029_911715035 3 Left 911715029 1:101123234-101123256 CCTCCTGACCGCAGCCACTCTGG No data
Right 911715035 1:101123260-101123282 CATCCAGTTCATTCTCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911715035 Original CRISPR CATCCAGTTCATTCTCCTTG TGG Intergenic
No off target data available for this crispr