ID: 911717664

View in Genome Browser
Species Human (GRCh38)
Location 1:101152828-101152850
Sequence CCCCAGATGCTGTCCTACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911717658_911717664 30 Left 911717658 1:101152775-101152797 CCCTGAGACAGAGCCATGGGTGC No data
Right 911717664 1:101152828-101152850 CCCCAGATGCTGTCCTACAATGG No data
911717659_911717664 29 Left 911717659 1:101152776-101152798 CCTGAGACAGAGCCATGGGTGCT No data
Right 911717664 1:101152828-101152850 CCCCAGATGCTGTCCTACAATGG No data
911717660_911717664 17 Left 911717660 1:101152788-101152810 CCATGGGTGCTTCTCAGTAACTA No data
Right 911717664 1:101152828-101152850 CCCCAGATGCTGTCCTACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911717664 Original CRISPR CCCCAGATGCTGTCCTACAA TGG Intergenic