ID: 911717664 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:101152828-101152850 |
Sequence | CCCCAGATGCTGTCCTACAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
911717658_911717664 | 30 | Left | 911717658 | 1:101152775-101152797 | CCCTGAGACAGAGCCATGGGTGC | No data | ||
Right | 911717664 | 1:101152828-101152850 | CCCCAGATGCTGTCCTACAATGG | No data | ||||
911717659_911717664 | 29 | Left | 911717659 | 1:101152776-101152798 | CCTGAGACAGAGCCATGGGTGCT | No data | ||
Right | 911717664 | 1:101152828-101152850 | CCCCAGATGCTGTCCTACAATGG | No data | ||||
911717660_911717664 | 17 | Left | 911717660 | 1:101152788-101152810 | CCATGGGTGCTTCTCAGTAACTA | No data | ||
Right | 911717664 | 1:101152828-101152850 | CCCCAGATGCTGTCCTACAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
911717664 | Original CRISPR | CCCCAGATGCTGTCCTACAA TGG | Intergenic | ||