ID: 911718597

View in Genome Browser
Species Human (GRCh38)
Location 1:101165221-101165243
Sequence CTGCTGAAGGGTAAGTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911718588_911718597 4 Left 911718588 1:101165194-101165216 CCTGCCCAGTTTAATACAACCCC No data
Right 911718597 1:101165221-101165243 CTGCTGAAGGGTAAGTAGGAAGG No data
911718589_911718597 0 Left 911718589 1:101165198-101165220 CCCAGTTTAATACAACCCCTTCT No data
Right 911718597 1:101165221-101165243 CTGCTGAAGGGTAAGTAGGAAGG No data
911718590_911718597 -1 Left 911718590 1:101165199-101165221 CCAGTTTAATACAACCCCTTCTC No data
Right 911718597 1:101165221-101165243 CTGCTGAAGGGTAAGTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911718597 Original CRISPR CTGCTGAAGGGTAAGTAGGA AGG Intergenic
No off target data available for this crispr