ID: 911718690

View in Genome Browser
Species Human (GRCh38)
Location 1:101166202-101166224
Sequence ATAGAGAAGAGGCCAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911718690_911718701 14 Left 911718690 1:101166202-101166224 CCATCCTCTGGCCTCTTCTCTAT No data
Right 911718701 1:101166239-101166261 CTGGTGACCTCATCTAATCTTGG No data
911718690_911718693 -5 Left 911718690 1:101166202-101166224 CCATCCTCTGGCCTCTTCTCTAT No data
Right 911718693 1:101166220-101166242 TCTATCCATAACCCCTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911718690 Original CRISPR ATAGAGAAGAGGCCAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr