ID: 911718693

View in Genome Browser
Species Human (GRCh38)
Location 1:101166220-101166242
Sequence TCTATCCATAACCCCTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911718689_911718693 3 Left 911718689 1:101166194-101166216 CCAGGGCTCCATCCTCTGGCCTC No data
Right 911718693 1:101166220-101166242 TCTATCCATAACCCCTCCCCTGG No data
911718691_911718693 -9 Left 911718691 1:101166206-101166228 CCTCTGGCCTCTTCTCTATCCAT No data
Right 911718693 1:101166220-101166242 TCTATCCATAACCCCTCCCCTGG No data
911718684_911718693 28 Left 911718684 1:101166169-101166191 CCTAATCTCTAAACATTGGAGGG No data
Right 911718693 1:101166220-101166242 TCTATCCATAACCCCTCCCCTGG No data
911718690_911718693 -5 Left 911718690 1:101166202-101166224 CCATCCTCTGGCCTCTTCTCTAT No data
Right 911718693 1:101166220-101166242 TCTATCCATAACCCCTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911718693 Original CRISPR TCTATCCATAACCCCTCCCC TGG Intergenic
No off target data available for this crispr