ID: 911718701

View in Genome Browser
Species Human (GRCh38)
Location 1:101166239-101166261
Sequence CTGGTGACCTCATCTAATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911718692_911718701 3 Left 911718692 1:101166213-101166235 CCTCTTCTCTATCCATAACCCCT No data
Right 911718701 1:101166239-101166261 CTGGTGACCTCATCTAATCTTGG No data
911718694_911718701 -9 Left 911718694 1:101166225-101166247 CCATAACCCCTCCCCTGGTGACC No data
Right 911718701 1:101166239-101166261 CTGGTGACCTCATCTAATCTTGG No data
911718690_911718701 14 Left 911718690 1:101166202-101166224 CCATCCTCTGGCCTCTTCTCTAT No data
Right 911718701 1:101166239-101166261 CTGGTGACCTCATCTAATCTTGG No data
911718691_911718701 10 Left 911718691 1:101166206-101166228 CCTCTGGCCTCTTCTCTATCCAT No data
Right 911718701 1:101166239-101166261 CTGGTGACCTCATCTAATCTTGG No data
911718689_911718701 22 Left 911718689 1:101166194-101166216 CCAGGGCTCCATCCTCTGGCCTC No data
Right 911718701 1:101166239-101166261 CTGGTGACCTCATCTAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911718701 Original CRISPR CTGGTGACCTCATCTAATCT TGG Intergenic
No off target data available for this crispr