ID: 911718996

View in Genome Browser
Species Human (GRCh38)
Location 1:101169371-101169393
Sequence GGATGCACGAAGCGTTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911718996_911718999 26 Left 911718996 1:101169371-101169393 CCTGGCTAACGCTTCGTGCATCC No data
Right 911718999 1:101169420-101169442 TTTGCCCCTCAATCCTCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911718996 Original CRISPR GGATGCACGAAGCGTTAGCC AGG (reversed) Intergenic
No off target data available for this crispr