ID: 911729297

View in Genome Browser
Species Human (GRCh38)
Location 1:101276300-101276322
Sequence TAGTAACAGCAAAAGAAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911729294_911729297 26 Left 911729294 1:101276251-101276273 CCACTAGACTGCAAGGTCATTTA No data
Right 911729297 1:101276300-101276322 TAGTAACAGCAAAAGAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911729297 Original CRISPR TAGTAACAGCAAAAGAAGTG GGG Intergenic
No off target data available for this crispr