ID: 911729937

View in Genome Browser
Species Human (GRCh38)
Location 1:101282437-101282459
Sequence ATAAAAAGTCTTGCTTTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911729937_911729942 16 Left 911729937 1:101282437-101282459 CCCCCTAAAGCAAGACTTTTTAT No data
Right 911729942 1:101282476-101282498 CCTGCCTTGACTTTACATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911729937 Original CRISPR ATAAAAAGTCTTGCTTTAGG GGG (reversed) Intergenic