ID: 911732364

View in Genome Browser
Species Human (GRCh38)
Location 1:101304412-101304434
Sequence GAATGGAGCAAGTGCCAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911732359_911732364 13 Left 911732359 1:101304376-101304398 CCTAGTTTTTGGAGCTCGCCTAT No data
Right 911732364 1:101304412-101304434 GAATGGAGCAAGTGCCAGTAGGG No data
911732360_911732364 -5 Left 911732360 1:101304394-101304416 CCTATCCTGCATCACTATGAATG No data
Right 911732364 1:101304412-101304434 GAATGGAGCAAGTGCCAGTAGGG No data
911732362_911732364 -10 Left 911732362 1:101304399-101304421 CCTGCATCACTATGAATGGAGCA No data
Right 911732364 1:101304412-101304434 GAATGGAGCAAGTGCCAGTAGGG No data
911732356_911732364 25 Left 911732356 1:101304364-101304386 CCTGGGCTGAGCCCTAGTTTTTG No data
Right 911732364 1:101304412-101304434 GAATGGAGCAAGTGCCAGTAGGG No data
911732355_911732364 28 Left 911732355 1:101304361-101304383 CCGCCTGGGCTGAGCCCTAGTTT No data
Right 911732364 1:101304412-101304434 GAATGGAGCAAGTGCCAGTAGGG No data
911732358_911732364 14 Left 911732358 1:101304375-101304397 CCCTAGTTTTTGGAGCTCGCCTA No data
Right 911732364 1:101304412-101304434 GAATGGAGCAAGTGCCAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911732364 Original CRISPR GAATGGAGCAAGTGCCAGTA GGG Intergenic
No off target data available for this crispr