ID: 911737816

View in Genome Browser
Species Human (GRCh38)
Location 1:101356826-101356848
Sequence CTGCTGAGAATGTGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911737816_911737820 29 Left 911737816 1:101356826-101356848 CCTTTTTTCCACATTCTCAGCAG No data
Right 911737820 1:101356878-101356900 TAGCAATTCTGACAGGTATGAGG No data
911737816_911737819 22 Left 911737816 1:101356826-101356848 CCTTTTTTCCACATTCTCAGCAG No data
Right 911737819 1:101356871-101356893 TTGATAATAGCAATTCTGACAGG 0: 3
1: 130
2: 1976
3: 5410
4: 6922

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911737816 Original CRISPR CTGCTGAGAATGTGGAAAAA AGG (reversed) Intergenic
No off target data available for this crispr