ID: 911738395

View in Genome Browser
Species Human (GRCh38)
Location 1:101361883-101361905
Sequence CACAGCTCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911738395_911738398 11 Left 911738395 1:101361883-101361905 CCAGTAACAGGCCAAGAGCTGTG No data
Right 911738398 1:101361917-101361939 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247
911738395_911738400 16 Left 911738395 1:101361883-101361905 CCAGTAACAGGCCAAGAGCTGTG No data
Right 911738400 1:101361922-101361944 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284
911738395_911738399 15 Left 911738395 1:101361883-101361905 CCAGTAACAGGCCAAGAGCTGTG No data
Right 911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911738395 Original CRISPR CACAGCTCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr