ID: 911741428

View in Genome Browser
Species Human (GRCh38)
Location 1:101390160-101390182
Sequence ATGTTTGTACACATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 318}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911741423_911741428 10 Left 911741423 1:101390127-101390149 CCTGACACATGGCCGGGACTCTG 0: 1
1: 0
2: 1
3: 25
4: 217
Right 911741428 1:101390160-101390182 ATGTTTGTACACATGGAGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 318
911741424_911741428 -2 Left 911741424 1:101390139-101390161 CCGGGACTCTGTTTGTGATGAAT 0: 1
1: 0
2: 1
3: 14
4: 149
Right 911741428 1:101390160-101390182 ATGTTTGTACACATGGAGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 318
911741418_911741428 23 Left 911741418 1:101390114-101390136 CCTCACATCTCCTCCTGACACAT 0: 1
1: 0
2: 2
3: 26
4: 307
Right 911741428 1:101390160-101390182 ATGTTTGTACACATGGAGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 318
911741422_911741428 13 Left 911741422 1:101390124-101390146 CCTCCTGACACATGGCCGGGACT 0: 1
1: 0
2: 0
3: 10
4: 91
Right 911741428 1:101390160-101390182 ATGTTTGTACACATGGAGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911741428 Original CRISPR ATGTTTGTACACATGGAGGA GGG Intergenic
900075424 1:812377-812399 ATGTTGGTGGAAATGGAGGATGG + Intergenic
902620231 1:17646551-17646573 GTGTGTGTGCACATGGAGGTAGG - Intronic
903812186 1:26040918-26040940 ATGTTTGTAGAGATGGGGGGGGG - Intronic
904032785 1:27543545-27543567 AGGTTTGCACACATGGAGACCGG - Intronic
906045547 1:42828102-42828124 ATGTTAGAAGAGATGGAGGAAGG + Intronic
907052636 1:51340023-51340045 CTGTGTCTTCACATGGAGGAAGG - Intronic
907571379 1:55487319-55487341 ATGTTTCTATACCTGGAGGAAGG - Intergenic
908654807 1:66376894-66376916 ATGTATGTACTCGTGGATGAAGG + Intergenic
909076890 1:71059894-71059916 ATATCTGTAAACATGGAGAAGGG + Intergenic
909405140 1:75280778-75280800 ATCTTTCTTCACATGGAGGCAGG - Intronic
909728434 1:78864510-78864532 ATTTTTGTACACATGTATGGTGG + Intergenic
910123752 1:83818294-83818316 ATGTTTCCACTCATGGTGGACGG - Intergenic
910256342 1:85250955-85250977 ATATTTGCAAACCTGGAGGATGG + Intronic
911741428 1:101390160-101390182 ATGTTTGTACACATGGAGGAGGG + Intergenic
916899649 1:169207125-169207147 CTGTTTCTACTCATGGTGGAAGG + Intronic
917599754 1:176562292-176562314 AGGTTTGTACTCAAGGTGGAGGG + Intronic
917891300 1:179441016-179441038 AAGTTTGTCCACCTGGAGTAGGG + Intronic
917981110 1:180269998-180270020 ATGTGTGTACACAGTGAGGGGGG - Intronic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
918327327 1:183422377-183422399 AAATTTTTACACATGGTGGAAGG - Intergenic
918412737 1:184277135-184277157 ATGCTTCCACTCATGGAGGAAGG - Intergenic
918819902 1:189239685-189239707 ATGTGTGTACAGATTGAGGTAGG + Intergenic
921610013 1:217201320-217201342 ATGTTTGTAAACATAAAGAAAGG - Intergenic
921650792 1:217675152-217675174 AGGTTTGTAGAGAAGGAGGATGG + Intronic
922271268 1:224037251-224037273 ATGTTGGTGGAAATGGAGGATGG + Intergenic
922362710 1:224837954-224837976 ATGCTTGTTCACATTGAGGGAGG - Intergenic
922861695 1:228823339-228823361 GTGTTTATCCACATAGAGGACGG + Intergenic
922990886 1:229910164-229910186 CTGTTTCCACACATGGTGGAAGG - Intergenic
924012411 1:239680059-239680081 ATGTTTTTACACAAAGAGAAGGG - Intronic
1063209311 10:3864435-3864457 ATGTTTCTACACACCAAGGAAGG + Intergenic
1064548472 10:16475009-16475031 CTGTGTGTTCACATGGTGGAAGG + Intronic
1065412893 10:25449792-25449814 ATATCTGTATACATTGAGGAAGG - Intronic
1065763155 10:29002019-29002041 ATGTTGCTACACTTTGAGGATGG + Intergenic
1066425124 10:35301279-35301301 ATGTGTGTAGACATGATGGAAGG + Intronic
1067517408 10:46963580-46963602 ATGTGTGTACAGAGGGATGAGGG + Intronic
1067644840 10:48088249-48088271 ATGTCTGTACAGAGGGATGAGGG - Intergenic
1068580299 10:58731641-58731663 AAGCTTGTACTCATGGCGGAAGG + Intronic
1071330475 10:84553905-84553927 ATGTCTGTGCCCAGGGAGGATGG + Intergenic
1072365846 10:94708388-94708410 ATTTTTGTACACATTTAGGGGGG + Intronic
1073046938 10:100644977-100644999 ATGTGTGTACACATGGTTGTGGG - Intergenic
1073141084 10:101248235-101248257 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1073982982 10:109175953-109175975 AAGCTTTTACTCATGGAGGAAGG - Intergenic
1074589393 10:114798558-114798580 ATTTTTGTAGACATGGGGGGGGG - Intergenic
1074616460 10:115073672-115073694 ACCTTTGGAGACATGGAGGAAGG + Intergenic
1075200312 10:120396899-120396921 ATGTTTGTAACCACGTAGGAGGG + Intergenic
1075417700 10:122277573-122277595 CTGCTTGTACTCATGGTGGAAGG + Intronic
1076079892 10:127569895-127569917 ATGTTCTCAGACATGGAGGAAGG + Intergenic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1079436344 11:20455960-20455982 AGGTTTATAAACTTGGAGGAAGG + Intronic
1081116805 11:39212624-39212646 ATGGTGGTACACGTGGAGAAAGG - Intergenic
1082862548 11:57869789-57869811 AAGCTTTTACTCATGGAGGAAGG + Intergenic
1084117796 11:67052114-67052136 GGGACTGTACACATGGAGGAGGG + Intergenic
1086386434 11:86313737-86313759 ATGTTTGTACAAAGTGTGGAGGG + Intronic
1087353689 11:97066452-97066474 ATACTTGATCACATGGAGGAAGG + Intergenic
1088568794 11:111201134-111201156 ATGTATCTTCACATGGAGGAAGG + Intergenic
1089575759 11:119441928-119441950 AAGCTTTTACTCATGGAGGAAGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091167627 11:133493432-133493454 ATGCATGTACACATGGGGGAAGG - Intronic
1091993404 12:4974190-4974212 ATGTTTATAGAAATGGAAGAAGG - Intergenic
1093193034 12:16097044-16097066 ATGTTTCTTCACATGTAGTAAGG + Intergenic
1093269458 12:17041495-17041517 GTGCTTGCACGCATGGAGGAAGG - Intergenic
1095076903 12:37941196-37941218 ATTTTTGTATACATGGTGAAGGG - Intergenic
1098300278 12:69047326-69047348 ATTCTTGTAAAGATGGAGGATGG + Intergenic
1099943567 12:89218927-89218949 ATGTTTGAACAGATGAAGCATGG - Intergenic
1100181593 12:92092184-92092206 ATGTTCGTACACATTGAGCCAGG - Intronic
1100729938 12:97453790-97453812 ATGTTTGAAGAAATGGAGGGAGG - Intergenic
1101918320 12:108912925-108912947 AAGCTTTTACTCATGGAGGAAGG - Intronic
1103071323 12:117945022-117945044 AAGTGTGTACACATTTAGGATGG - Intronic
1103600890 12:122053915-122053937 AAATTTGTACGCATGGAGGGAGG + Intronic
1106273319 13:28176100-28176122 ATGGTAGTACAAATGGAGAAAGG + Intronic
1106346258 13:28882036-28882058 ATTTTTGTACACATGGTGTGAGG - Intronic
1107210754 13:37851810-37851832 AAGTCTGTGCACTTGGAGGAGGG + Intronic
1107747285 13:43524052-43524074 ATGGCTGTAGCCATGGAGGATGG - Intronic
1108821898 13:54362078-54362100 ATCTTTTTACACTTGGAGGCAGG + Intergenic
1111592767 13:90371208-90371230 ATTTTTGTACAGATGGGTGAGGG + Intergenic
1111801435 13:92986243-92986265 AAGTTTTTACTCATGGTGGAAGG - Intergenic
1113101391 13:106723277-106723299 ATGTGCGTACACAGGGAGAATGG + Intergenic
1113224821 13:108147845-108147867 ATGATTGAATAGATGGAGGATGG - Intergenic
1113799633 13:113079741-113079763 AGGATTGTCCACACGGAGGAGGG + Intronic
1116584301 14:46683156-46683178 ATGTTTGATTACATGGAGGTGGG - Intergenic
1117184987 14:53231118-53231140 ATGTGTGTACATATAGCGGAAGG + Intergenic
1117283908 14:54267448-54267470 AGTTTTGTGCACATGGAGGTTGG - Intergenic
1117720956 14:58628266-58628288 ATGTTTGTTGAATTGGAGGAAGG - Intergenic
1117761195 14:59030724-59030746 CTGTTTCTACTCATGGTGGAAGG - Intergenic
1118655128 14:67939213-67939235 ATGTGTTTCCACATGGAGGGGGG - Intronic
1118669205 14:68103635-68103657 GTGTTAGTACAAATTGAGGAAGG + Intronic
1119908329 14:78325759-78325781 ATGTTTGTACAAATGGAAACAGG - Intronic
1120642116 14:87028170-87028192 ATGTTTTTCCACACGGTGGAAGG - Intergenic
1121963710 14:98285199-98285221 ATGAGTGTAGACTTGGAGGAGGG + Intergenic
1122146835 14:99695473-99695495 AGGTGTGTACACATTTAGGATGG + Intronic
1123428547 15:20193743-20193765 ATGTTTATAGGGATGGAGGAAGG + Intergenic
1125220292 15:37324915-37324937 ATTTTTGTATATATGGAGTAAGG - Intergenic
1125780078 15:42257403-42257425 CTGTTTCTACTCATGGTGGAAGG - Intronic
1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG + Intronic
1128643636 15:69359104-69359126 ATGTGTCTTCACATGGTGGAAGG + Intronic
1130784927 15:87085530-87085552 ATGCTGGTCCACATGGTGGAGGG + Intergenic
1131374660 15:91913734-91913756 ATATTTGTAGATTTGGAGGAAGG + Intronic
1132025257 15:98399648-98399670 CTGTGTGCTCACATGGAGGAAGG - Intergenic
1132171093 15:99656255-99656277 ATGTTAGTAGATGTGGAGGATGG - Intronic
1134979756 16:18597714-18597736 ATGTGTGTAGACATGCTGGAAGG + Intergenic
1137264904 16:46860689-46860711 ATTTTTGTACAAATGGAGAATGG + Intergenic
1137390921 16:48081000-48081022 ATGTGTCCTCACATGGAGGAAGG + Intergenic
1137737110 16:50733079-50733101 ATGTTTGGTCACAAGGAAGATGG - Intergenic
1140021386 16:71242378-71242400 ATGTTTGCTCACATGAATGAAGG - Intergenic
1144342806 17:14324155-14324177 CTGTTTTTACACATGGAGACAGG + Intronic
1144458180 17:15436042-15436064 ACGTTTATAGACATGGAGGCAGG - Exonic
1147839391 17:43360154-43360176 ATGCTTGTACACATGGGGAGAGG + Intergenic
1149436041 17:56634216-56634238 CTGTGTCTACACATGGTGGAAGG + Intergenic
1150310576 17:64125799-64125821 ATGTTTTTTTACATGGATGATGG + Intronic
1153114171 18:1634227-1634249 ATGTTTGTAAACATAAAGAAAGG - Intergenic
1153877021 18:9383032-9383054 ATGTTTGTAAATAAGGAGAAGGG + Intronic
1154126480 18:11696959-11696981 AAGTTTGTGCAACTGGAGGATGG - Intronic
1155080787 18:22407942-22407964 ATGTTTGTAAACAGGGCAGAGGG - Intergenic
1155135824 18:22991497-22991519 ATTTTGGTACCCATGGGGGAGGG - Intronic
1155798187 18:30066332-30066354 CTGTTTCTTCACATGGAGGAAGG + Intergenic
1157049273 18:44141930-44141952 ATGTATCTTCACATGGTGGAAGG - Intergenic
1157110777 18:44818238-44818260 ATGTTTTTTCACATGCAGAAAGG + Intronic
1158883529 18:61804323-61804345 CTGTGTGTTCACATGGCGGAAGG + Intergenic
1159100504 18:63952814-63952836 ATGTTTTTATAAATGGAGGAAGG - Intronic
1159262025 18:66026448-66026470 CTGTTTCTACTCATGGTGGAAGG - Intergenic
1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG + Intergenic
1163750528 19:19074511-19074533 ATGTTTGTACAAATGTTGGGTGG - Intronic
1167762663 19:51459110-51459132 ATGTTGATACACACGAAGGACGG + Intergenic
1168449859 19:56457937-56457959 CTGTGTCTGCACATGGAGGAAGG - Intronic
927815740 2:26215797-26215819 AAGATGGTACACAAGGAGGAAGG + Intronic
928447799 2:31348334-31348356 ATCTGTGTACACATGAAGTAGGG + Exonic
929012410 2:37458088-37458110 ATGTCATTACACATGGAGAAAGG - Intergenic
929396087 2:41524130-41524152 ATGTTTTTAAACATGGAAGAGGG + Intergenic
929403580 2:41613895-41613917 CTGTTTGTATACATGGTGGCTGG - Intergenic
929434611 2:41918944-41918966 TTGTTGGTATAGATGGAGGATGG + Intergenic
930342066 2:50129578-50129600 ATATTAGGACACATGGAGCATGG - Intronic
930465423 2:51742111-51742133 AAGTCTGTACACAAGAAGGAAGG - Intergenic
931124210 2:59255681-59255703 ATGTTTGTTCACATTGAGGGAGG + Intergenic
931763264 2:65434473-65434495 ATCTCTGTAGACATGGAGTAGGG + Intergenic
931998238 2:67859459-67859481 GTGTGTGTGCACATGGAGGGTGG - Intergenic
932702305 2:74000261-74000283 AAGTTTCTACACAAGGAGGGTGG - Intronic
933318899 2:80747217-80747239 GAGTTTGTACTCATGGCGGAAGG - Intergenic
933350794 2:81149988-81150010 ATTTATGTACACGTGGAGGGTGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937362832 2:121240929-121240951 ATGTGTGTGGACATGCAGGAGGG - Intronic
938771411 2:134504394-134504416 ATGAATATACACATGGATGATGG + Intronic
939089747 2:137765806-137765828 ATGTTTGTAGTCAGGGAGCATGG + Intergenic
940469534 2:154077816-154077838 ATGTCTGTCCACATGGGGGAAGG + Intronic
942438644 2:176008214-176008236 ATGTTCTTACATATGGAGAAAGG + Intergenic
942628169 2:177925995-177926017 ATTTTTCTTCAAATGGAGGAAGG - Intronic
942629498 2:177940146-177940168 ATGGTTGTACAACTGGGGGATGG + Intronic
943875645 2:193063963-193063985 ATATTTGTACCCATTAAGGAAGG + Intergenic
944542378 2:200766265-200766287 ATGTTTGTTCCCATGGATGATGG - Intergenic
944646573 2:201786316-201786338 ATGTTTGTATGCATGGAGGGAGG - Intergenic
945476139 2:210284909-210284931 AAATTTGTACCCATGGAGCAAGG + Intergenic
945529355 2:210931277-210931299 AAGCTTATACACAGGGAGGAGGG - Intergenic
946045897 2:216820733-216820755 ATGTATCTTCACATGGTGGAAGG - Intergenic
947829714 2:233130355-233130377 ATGTTTGCAAACCTGGACGAAGG - Intronic
947962466 2:234251175-234251197 ACGTTTGTTCACAAGGATGAAGG + Intergenic
1169357372 20:4918914-4918936 GTGTGTGCACACATTGAGGAGGG - Intronic
1169827898 20:9789994-9790016 ATGCTTGAAGACATTGAGGAGGG + Intronic
1172470525 20:35190819-35190841 ATCTTTGAACATATGTAGGACGG - Intergenic
1172803882 20:37597684-37597706 ATGTTTGAATAAATGGAGGGAGG + Intergenic
1173653306 20:44681515-44681537 ATGTGTGAACAAATGCAGGATGG + Intergenic
1174577279 20:51545515-51545537 ATGTGTGGATAAATGGAGGATGG + Intronic
1174770238 20:53292695-53292717 CTGTTAGTACACATGCAGCATGG - Intronic
1175256617 20:57651911-57651933 ATATTTATACACAGGGAGGTGGG + Exonic
1175744080 20:61441656-61441678 ATGTGTGCTCACATGGAAGACGG - Intronic
1176153653 20:63607034-63607056 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153660 20:63607067-63607089 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153667 20:63607100-63607122 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153685 20:63607201-63607223 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153692 20:63607234-63607256 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153718 20:63607370-63607392 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153733 20:63607436-63607458 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153753 20:63607539-63607561 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153761 20:63607573-63607595 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153789 20:63607711-63607733 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153818 20:63607848-63607870 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153941 20:63608492-63608514 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153955 20:63608560-63608582 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153975 20:63608662-63608684 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153989 20:63608730-63608752 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154003 20:63608798-63608820 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154031 20:63608935-63608957 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154119 20:63609416-63609438 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154140 20:63609518-63609540 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154153 20:63609585-63609607 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154167 20:63609652-63609674 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154174 20:63609685-63609707 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154188 20:63609754-63609776 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154196 20:63609788-63609810 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154223 20:63609926-63609948 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154231 20:63609960-63609982 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1177072913 21:16533398-16533420 ATGTGTTTACACATGGAAAAGGG + Intergenic
1177619105 21:23563334-23563356 ATATTTGTACATTTGAAGGATGG + Intergenic
1178340630 21:31783158-31783180 ATGTTTTCACACAAGGAAGAGGG - Intergenic
1178789369 21:35685228-35685250 AGGGTTGTCCACATGGAGAAGGG + Intronic
1179722002 21:43321429-43321451 CTGTTTCTCCACATAGAGGATGG + Intergenic
1181048958 22:20229765-20229787 GTGTGTGTCCACATGGGGGAAGG - Intergenic
1181856499 22:25785030-25785052 ATATTTGTACCCATGGAGTGGGG + Intronic
1183080363 22:35452068-35452090 TGGTTTTTACACATGGATGAGGG - Intergenic
1185181842 22:49368232-49368254 CTGTTTGGGCACCTGGAGGATGG - Intergenic
949479117 3:4476718-4476740 TTGGTTTTGCACATGGAGGAAGG + Intergenic
950623416 3:14226110-14226132 ATGTTTCTGCAATTGGAGGAGGG - Intergenic
954872928 3:53781340-53781362 GTGTTTGTTCCCATGGTGGAGGG + Intronic
955023342 3:55142830-55142852 ATGTTTGTGTATATGGAGAATGG + Intergenic
957669170 3:83278424-83278446 ATGTTTCCTCACATGGGGGAAGG - Intergenic
958667065 3:97154624-97154646 ATGTTTTTAAAGGTGGAGGAAGG - Intronic
961530136 3:127535659-127535681 ATGTTTGACCAAAGGGAGGAAGG - Intergenic
963479970 3:145860065-145860087 GTGTGTGTACACATGTGGGATGG + Intergenic
964832748 3:160903714-160903736 GTGTGTGCACACATGGAGGTGGG + Intronic
965970860 3:174554951-174554973 ATGTTTCTTCACATAGTGGAAGG + Intronic
966294243 3:178400329-178400351 AAGTTTTTACTCATGGAGGAAGG - Intergenic
967775442 3:193381503-193381525 ATGTTTATACACGTGCTGGAGGG + Intergenic
969132602 4:5002785-5002807 ATCTTTGAAAACATGGAGGCAGG + Intergenic
969453975 4:7290658-7290680 ATGTGTGCATACATGGATGAGGG - Intronic
974587187 4:63895185-63895207 TTTTTTGTACACATGTAGGAGGG - Intergenic
974601590 4:64089840-64089862 CTGTTTCTACTCATGGCGGAAGG + Intergenic
975349199 4:73327373-73327395 ATGGATGCACATATGGAGGATGG - Intergenic
975519755 4:75287754-75287776 ATGTTTGTCCACATACAAGAAGG + Intergenic
976416083 4:84777048-84777070 CTGTTTATACACAGGGAAGAAGG + Intronic
976989243 4:91344197-91344219 ATGTGTTCTCACATGGAGGAAGG - Intronic
977603765 4:98961474-98961496 CTGTGTCTTCACATGGAGGAAGG - Intergenic
978521163 4:109616726-109616748 ATGCTTGTACACAGAGAAGATGG - Intronic
979729262 4:124003941-124003963 ATTTTTGAACAGAGGGAGGAAGG + Intergenic
980668268 4:135969074-135969096 ATGTGTGTGGACATGGAGTATGG - Intergenic
981052502 4:140323294-140323316 AAGTTTTTACTCATGGTGGAAGG - Intronic
981638803 4:146911933-146911955 ATGTCTGCAAAGATGGAGGAAGG + Intronic
982572545 4:157068495-157068517 CTGTGTCTTCACATGGAGGAAGG + Intergenic
983361662 4:166732135-166732157 ATTTTTGTACATATAGGGGATGG - Intergenic
984809172 4:183779029-183779051 TTGTTTGTGGAAATGGAGGATGG - Intergenic
985149572 4:186932615-186932637 ATGTGTCTAAAAATGGAGGAAGG - Intergenic
985213492 4:187621766-187621788 GTGTTTGTATACATGGAGAGTGG - Intergenic
987070221 5:14329434-14329456 ATGTGTCCTCACATGGAGGAAGG - Intronic
991046080 5:62224154-62224176 ATGTTTATAGGGATGGAGGAAGG + Intergenic
992355265 5:75975410-75975432 ATGTCTATAGACATGGAGCAAGG - Intergenic
992845108 5:80738914-80738936 GTGTGTCTTCACATGGAGGAGGG - Intronic
993520373 5:88892167-88892189 GTGCTTGTAGACATGGAAGAAGG + Intronic
993799617 5:92316672-92316694 ATTTTTGTGCAAATGGAGAAAGG + Intergenic
994132404 5:96245692-96245714 TTGGTTCTACACATGCAGGAAGG + Intergenic
997711496 5:136008512-136008534 ATGTTTGGACACATGGGGAGAGG + Intergenic
998515431 5:142749554-142749576 AAGCTTTTACTCATGGAGGAAGG - Intergenic
999213547 5:149912389-149912411 ATGTCTGTAAACATGCAGAATGG - Intronic
1000217168 5:159171377-159171399 ATGTTTCTAAATATGGAGAAAGG - Intronic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1003989241 6:11469454-11469476 AAGTTTCTACTCATGGTGGAAGG - Intergenic
1004050747 6:12076540-12076562 CTGTGTCTTCACATGGAGGAAGG + Intronic
1004176905 6:13347982-13348004 ATGTCTGTGAACATGGAGGGTGG + Intergenic
1004285852 6:14320024-14320046 ATCTTTTTACAAATGGAGCAAGG - Intergenic
1004581598 6:16959395-16959417 ATTTTTTTAGACATGAAGGATGG + Intergenic
1004826597 6:19428168-19428190 ATGGATGTACACATGGAGGAAGG - Intergenic
1005048406 6:21663698-21663720 ATGTTTGTTCACAAGCAGGTTGG + Intergenic
1005378816 6:25213143-25213165 AAGTGAGAACACATGGAGGAAGG + Intergenic
1007028970 6:38609512-38609534 GTGTATGTACACATAGAAGAAGG - Intronic
1007385584 6:41518216-41518238 CTGCATGTAAACATGGAGGAAGG + Intergenic
1007888165 6:45256382-45256404 CTGTTTCCTCACATGGAGGAAGG + Intronic
1008691666 6:53986157-53986179 ATGTTTGGAGACTAGGAGGAAGG - Intronic
1008806213 6:55431771-55431793 AGGTTTTTACTCATGGTGGAAGG - Intergenic
1009830598 6:68927150-68927172 ATGTATGTACACATGGTACATGG - Intronic
1011227937 6:85128229-85128251 ATGTATGTACATATGTATGAAGG + Intergenic
1011523463 6:88237205-88237227 ATGTTTGTTCAAATAGAGGCAGG - Intergenic
1012728769 6:102852404-102852426 GTGTGTGTACAAATGGAGTAAGG - Intergenic
1013348560 6:109285898-109285920 AAGTTTGTACACATGTACTAGGG + Intergenic
1017744582 6:157435330-157435352 GTGCTTGCACACATGGAGGGAGG + Intronic
1017857252 6:158360673-158360695 ATGTTGGAAGACATGGAAGATGG + Intronic
1018234535 6:161711006-161711028 TTGATTGTAGACATGGAGAAAGG + Intronic
1020516582 7:9128605-9128627 AAGCTTGTACTCATGGTGGAAGG - Intergenic
1020529201 7:9308674-9308696 ATTATTTTACACATGGAGAAAGG - Intergenic
1023215565 7:37859009-37859031 AAGCTTGTTCTCATGGAGGAAGG - Intronic
1023383490 7:39631945-39631967 AAGTTTTTACTCATGGAAGAAGG + Intronic
1024657479 7:51463924-51463946 ATGTGTCTTCACATGGTGGAAGG + Intergenic
1026241571 7:68579957-68579979 AAGTTCATCCACATGGAGGAGGG + Intergenic
1027957567 7:84900581-84900603 ACGTTTGTACTCATGGCGTATGG - Intergenic
1030609781 7:111676661-111676683 ATGTTTGTACATTTAGAAGATGG + Intergenic
1030627365 7:111858834-111858856 ATGTGTCTATACATGGAGGAAGG - Intronic
1032637596 7:133726872-133726894 ATGATTGTGAACATGGAGAATGG + Intronic
1032951764 7:136922535-136922557 ATGTGTGTAGACATAGAGTATGG - Intronic
1033193729 7:139308618-139308640 ATGTTTGGACAAGTAGAGGAAGG + Intergenic
1033753670 7:144379751-144379773 ATGTTAGGACACTTGGAGGCTGG + Intronic
1035288631 7:157822747-157822769 ATGCATGTACGCATGGATGATGG - Intronic
1035458874 7:159027118-159027140 AAGTTTGTACCGACGGAGGAAGG + Intergenic
1036002093 8:4617813-4617835 ATGAATATACTCATGGAGGAGGG - Intronic
1037579770 8:20237501-20237523 ATGTGTGTATACATGGGGGTAGG - Intergenic
1037579788 8:20237786-20237808 ATGTGTGTATACATGGGGGTAGG - Intergenic
1039858596 8:41437307-41437329 ATGTTCATATTCATGGAGGAAGG - Intergenic
1041174760 8:55183918-55183940 AGGTGTGTACACATTGAGGATGG + Intronic
1041627947 8:60052727-60052749 GTGATAGGACACATGGAGGAAGG - Intergenic
1044661590 8:94596604-94596626 AGGCTTGGACACATGGAGGTGGG - Intergenic
1044850817 8:96425481-96425503 TGGCTTCTACACATGGAGGAAGG + Intergenic
1045005789 8:97915527-97915549 GTGTAGGTACACAAGGAGGAAGG - Intronic
1045826658 8:106405607-106405629 ATGATTGTTCACATGGTGGCTGG - Intronic
1048357620 8:133666609-133666631 AGGTTTGGACAAATGGTGGAGGG - Intergenic
1049632520 8:143666337-143666359 ATGTGTGTGCACACGGAGGAGGG - Intergenic
1049632531 8:143666386-143666408 ATGTGTGTGCACACGGAGGGAGG - Intergenic
1049632543 8:143666435-143666457 ATGTGTGTGCACACAGAGGAGGG - Intergenic
1049632562 8:143666533-143666555 ATGTGTGTGCACACAGAGGAGGG - Intergenic
1049632573 8:143666582-143666604 ATGTGTGTGCACACGGAGGAGGG - Intergenic
1049632584 8:143666631-143666653 ATGTGTGTGCACACAGAGGAGGG - Intergenic
1049632595 8:143666679-143666701 ATGTGTGTGCACACAGAGGAGGG - Intergenic
1049632604 8:143666728-143666750 ATGTGTGTGCACACGGAGGGAGG - Intergenic
1049632616 8:143666777-143666799 ATGTGTGTGCACACAGAGGAGGG - Intergenic
1049632625 8:143666826-143666848 ATGTGTGTGCACACGGAGGGAGG - Intergenic
1049632661 8:143666978-143667000 ATGTATGTGCACATGGAGGAAGG - Intergenic
1049632672 8:143667028-143667050 ATGTGTGTGCACATGGAGGGAGG - Intergenic
1050054243 9:1635290-1635312 ATGTGTGTGCACATGCAGGTAGG - Intergenic
1050284359 9:4085828-4085850 AAGTTTCTACTCATGGCGGAAGG - Intronic
1051290216 9:15537919-15537941 ATGTTTGTCCCCATGGATGTAGG + Intergenic
1051452931 9:17217205-17217227 ATCTTTATACACATGGCAGAAGG + Intronic
1051493495 9:17693225-17693247 ATGTTTGGACACATGGATCAGGG + Intronic
1052698205 9:31906044-31906066 AAGCTTTTACTCATGGAGGAAGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1056735176 9:89203312-89203334 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1057745074 9:97745000-97745022 CTGTTTGAACATATGTAGGATGG - Intergenic
1058075778 9:100649279-100649301 ATTTTTGTACAAATGGAGAGGGG + Intergenic
1058940339 9:109807515-109807537 ATATATGTTCACATGGTGGAAGG + Intronic
1059208885 9:112492544-112492566 ATGTATGTACATATGTAGGTAGG - Intronic
1060706492 9:125806492-125806514 CTGTCTGTTCACATGGTGGAAGG + Intronic
1062305390 9:135903639-135903661 ATCTTTACACAAATGGAGGATGG + Intronic
1202630930 M:15660-15682 TTGTTTGGATATATGGAGGATGG - Intergenic
1185745552 X:2569869-2569891 AAGCTTTTACTCATGGAGGAAGG + Intergenic
1186117392 X:6319258-6319280 CTGTGTCTACACATGGTGGAAGG + Intergenic
1186387188 X:9121759-9121781 CTGTGTCTTCACATGGAGGAAGG - Intronic
1186687986 X:11945621-11945643 AAGTTTTTACTCATGGTGGAAGG + Intergenic
1186879129 X:13847161-13847183 ATGTTTGCACACATATAAGATGG - Intronic
1186983098 X:14979431-14979453 ATGTTTGCACTCATGGTGGAAGG + Intergenic
1188078848 X:25811656-25811678 ATATGTGTACACATGGAGTATGG - Intergenic
1188683252 X:33038583-33038605 AAGTTTGAACACATCGAGGCAGG - Intronic
1188760835 X:34027377-34027399 CTGTGTCTACACATGGTGGATGG - Intergenic
1191025641 X:55909951-55909973 ATGTTTCTGCACAGGGAGGGTGG + Intergenic
1193728367 X:85071363-85071385 ATTTTTGTACACATGAGGGTAGG + Intronic
1194827747 X:98583437-98583459 ATGTGTCTCCACATGGCGGAAGG - Intergenic
1194853078 X:98892627-98892649 AAGTTTTTACTCATGGTGGAAGG - Intergenic
1195509411 X:105696986-105697008 AAGCTTTTACTCATGGAGGAAGG + Intronic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1198034299 X:132785576-132785598 ATCATTGGACACTTGGAGGATGG + Intronic
1198641959 X:138766049-138766071 AGTTATGTAGACATGGAGGATGG - Intronic
1199025875 X:142937341-142937363 ATGCTTTTACACATGGCAGAAGG + Intergenic
1199734171 X:150668514-150668536 TTTTTTGTAGAGATGGAGGAGGG - Intronic
1200871844 Y:8109931-8109953 ATGTTTCTTCACATGGTGGCAGG + Intergenic
1201711463 Y:16997521-16997543 ATGTTTGTAGAGAGGAAGGATGG + Intergenic
1201939628 Y:19445982-19446004 ATGTTTCTACACAGGGAGATGGG - Intergenic