ID: 911742365

View in Genome Browser
Species Human (GRCh38)
Location 1:101400956-101400978
Sequence GACTGAGATGTGACTGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911742365_911742368 -7 Left 911742365 1:101400956-101400978 CCCAAAGCAGTCACATCTCAGTC No data
Right 911742368 1:101400972-101400994 CTCAGTCTGAATAAGGTCACAGG No data
911742365_911742369 26 Left 911742365 1:101400956-101400978 CCCAAAGCAGTCACATCTCAGTC No data
Right 911742369 1:101401005-101401027 TTTTTTTTTTTTTTTTGAGAAGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911742365 Original CRISPR GACTGAGATGTGACTGCTTT GGG (reversed) Intergenic
No off target data available for this crispr