ID: 911752174

View in Genome Browser
Species Human (GRCh38)
Location 1:101507969-101507991
Sequence CTGGAATTACTATCAAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911752173_911752174 -6 Left 911752173 1:101507952-101507974 CCTGTGGGGTAATTATGCTGGAA No data
Right 911752174 1:101507969-101507991 CTGGAATTACTATCAAAGACTGG No data
911752171_911752174 7 Left 911752171 1:101507939-101507961 CCATTGTGATTATCCTGTGGGGT No data
Right 911752174 1:101507969-101507991 CTGGAATTACTATCAAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911752174 Original CRISPR CTGGAATTACTATCAAAGAC TGG Intergenic
No off target data available for this crispr