ID: 911765130

View in Genome Browser
Species Human (GRCh38)
Location 1:101665048-101665070
Sequence TGTCATTCCCCTATTGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911765130_911765136 3 Left 911765130 1:101665048-101665070 CCCAAGCCAATAGGGGAATGACA No data
Right 911765136 1:101665074-101665096 CTGTAGGGGCTACCTGCATCAGG No data
911765130_911765137 4 Left 911765130 1:101665048-101665070 CCCAAGCCAATAGGGGAATGACA No data
Right 911765137 1:101665075-101665097 TGTAGGGGCTACCTGCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911765130 Original CRISPR TGTCATTCCCCTATTGGCTT GGG (reversed) Intergenic
No off target data available for this crispr