ID: 911770864

View in Genome Browser
Species Human (GRCh38)
Location 1:101740818-101740840
Sequence ATGACAGATTGAATCAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911770864_911770868 -4 Left 911770864 1:101740818-101740840 CCAACACTGATTCAATCTGTCAT No data
Right 911770868 1:101740837-101740859 TCATCAGGGTTACCTGAACCGGG No data
911770864_911770869 -1 Left 911770864 1:101740818-101740840 CCAACACTGATTCAATCTGTCAT No data
Right 911770869 1:101740840-101740862 TCAGGGTTACCTGAACCGGGAGG No data
911770864_911770867 -5 Left 911770864 1:101740818-101740840 CCAACACTGATTCAATCTGTCAT No data
Right 911770867 1:101740836-101740858 GTCATCAGGGTTACCTGAACCGG No data
911770864_911770870 3 Left 911770864 1:101740818-101740840 CCAACACTGATTCAATCTGTCAT No data
Right 911770870 1:101740844-101740866 GGTTACCTGAACCGGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911770864 Original CRISPR ATGACAGATTGAATCAGTGT TGG (reversed) Intergenic