ID: 911770870

View in Genome Browser
Species Human (GRCh38)
Location 1:101740844-101740866
Sequence GGTTACCTGAACCGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911770863_911770870 24 Left 911770863 1:101740797-101740819 CCAAATAGCACACTGCAGAAGCC No data
Right 911770870 1:101740844-101740866 GGTTACCTGAACCGGGAGGCTGG No data
911770864_911770870 3 Left 911770864 1:101740818-101740840 CCAACACTGATTCAATCTGTCAT No data
Right 911770870 1:101740844-101740866 GGTTACCTGAACCGGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911770870 Original CRISPR GGTTACCTGAACCGGGAGGC TGG Intergenic