ID: 911774735

View in Genome Browser
Species Human (GRCh38)
Location 1:101794146-101794168
Sequence ATGTTCTCCTAGGTCATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911774733_911774735 5 Left 911774733 1:101794118-101794140 CCTACAGAGCACGCGGTGAGAAA No data
Right 911774735 1:101794146-101794168 ATGTTCTCCTAGGTCATCAATGG No data
911774731_911774735 22 Left 911774731 1:101794101-101794123 CCAATAGAGAAAATAAGCCTACA No data
Right 911774735 1:101794146-101794168 ATGTTCTCCTAGGTCATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911774735 Original CRISPR ATGTTCTCCTAGGTCATCAA TGG Intergenic
No off target data available for this crispr