ID: 911779525

View in Genome Browser
Species Human (GRCh38)
Location 1:101858744-101858766
Sequence CAATTATAGTAGAAGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3194
Summary {0: 1, 1: 2, 2: 33, 3: 442, 4: 2716}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911779525_911779528 -9 Left 911779525 1:101858744-101858766 CCCTCTGCCTTCTACTATAATTG 0: 1
1: 2
2: 33
3: 442
4: 2716
Right 911779528 1:101858758-101858780 CTATAATTGTAAGTTCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911779525 Original CRISPR CAATTATAGTAGAAGGCAGA GGG (reversed) Intronic
Too many off-targets to display for this crispr