ID: 911779968

View in Genome Browser
Species Human (GRCh38)
Location 1:101864102-101864124
Sequence CAGTAACAACTGAAGTTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911779968_911779971 7 Left 911779968 1:101864102-101864124 CCTAACAACTTCAGTTGTTACTG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 911779971 1:101864132-101864154 TCATATGCAATTGGTTAATTGGG 0: 1
1: 0
2: 3
3: 21
4: 221
911779968_911779972 8 Left 911779968 1:101864102-101864124 CCTAACAACTTCAGTTGTTACTG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 911779972 1:101864133-101864155 CATATGCAATTGGTTAATTGGGG 0: 1
1: 0
2: 0
3: 12
4: 483
911779968_911779969 -2 Left 911779968 1:101864102-101864124 CCTAACAACTTCAGTTGTTACTG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 911779969 1:101864123-101864145 TGAATTAGCTCATATGCAATTGG No data
911779968_911779970 6 Left 911779968 1:101864102-101864124 CCTAACAACTTCAGTTGTTACTG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 911779970 1:101864131-101864153 CTCATATGCAATTGGTTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911779968 Original CRISPR CAGTAACAACTGAAGTTGTT AGG (reversed) Intronic
900979571 1:6038839-6038861 CAGCAACCCATGAAGTTGTTGGG - Intronic
904999556 1:34657607-34657629 CAGGAATAACTGCAGTTGATGGG - Intergenic
909222190 1:72979441-72979463 TAGTAAGAACTTAAGTTGTAAGG + Intergenic
910922430 1:92363492-92363514 CACTGAAAAATGAAGTTGTTAGG - Intronic
911779968 1:101864102-101864124 CAGTAACAACTGAAGTTGTTAGG - Intronic
912042639 1:105411430-105411452 CAGTCACAGCTGGAGTTGCTGGG - Intergenic
912068307 1:105775543-105775565 CATCAACAACTGAAAATGTTGGG + Intergenic
917053388 1:170950564-170950586 CAGTAACAACTGTAGATTCTGGG + Intronic
917183124 1:172321064-172321086 CAGTCATAACTGATGTTTTTAGG + Intronic
921117204 1:212104332-212104354 CTGTAACAACTGAAATTGCATGG + Exonic
922862230 1:228829232-228829254 CTTTATCAACTGAAGTTATTTGG - Intergenic
923607614 1:235458886-235458908 CAGAAACACATGCAGTTGTTTGG + Intronic
1063894798 10:10668567-10668589 GAGTAAAAACAGAAGTAGTTGGG - Intergenic
1065318746 10:24489138-24489160 CAGTAACAACTGCAGTATTCTGG - Intronic
1066094432 10:32058715-32058737 CAGGAACCAATGAAGGTGTTAGG - Intergenic
1067118429 10:43453607-43453629 CAGTAACATCTGTAGTTGTGTGG - Intronic
1067383513 10:45797038-45797060 TAGTAAAAAATGAAATTGTTAGG + Intergenic
1067891215 10:50137605-50137627 TAGTAATAAATGAAATTGTTAGG + Intergenic
1070064200 10:73017697-73017719 CGTAAGCAACTGAAGTTGTTAGG - Intronic
1071919085 10:90329242-90329264 CTATAACAACTGAAGGTGGTGGG - Intergenic
1074132679 10:110595561-110595583 CTAAAGCAACTGAAGTTGTTGGG - Intronic
1075971060 10:126653260-126653282 CTGTAGCATGTGAAGTTGTTTGG + Intronic
1076634875 10:131875599-131875621 CAGAAGCAGCTGAAGGTGTTGGG - Intergenic
1079000224 11:16747242-16747264 CATTAACACTTGAAGTTTTTCGG + Intronic
1081015147 11:37868673-37868695 CAGTAAAAAATGAAAATGTTAGG - Intergenic
1081047279 11:38291740-38291762 CAATAAGAACTGATGTGGTTTGG - Intergenic
1081170341 11:39861301-39861323 CAGTAAGAAATGGAGTTGTTTGG - Intergenic
1088263120 11:107963838-107963860 GAGTACCAAGTGAAGTTTTTTGG + Intergenic
1089039220 11:115430346-115430368 AAGTAACAAATGAAGTTTTGAGG - Intronic
1090165349 11:124540863-124540885 CAGCAACAACTGTTGTTTTTAGG + Intergenic
1092836665 12:12496023-12496045 CAGTAACAGCTGAAGTGATATGG + Intronic
1093570502 12:20661587-20661609 CAGTGACAACTGGAGTGGTTGGG - Intronic
1097352774 12:58566640-58566662 CACTAAAAACTGGAGTTTTTAGG + Intronic
1098610824 12:72455576-72455598 CAGTAACAAATGGAAGTGTTGGG + Intronic
1100080685 12:90846442-90846464 GAGAAACAACAGAAGTTGTGGGG - Intergenic
1101509691 12:105381458-105381480 CAATAACAACTGGAAGTGTTGGG - Intronic
1101916835 12:108902464-108902486 CAATAATAACTGTTGTTGTTAGG - Intergenic
1103277014 12:119720656-119720678 AACTAAAAAGTGAAGTTGTTAGG + Intronic
1109215420 13:59584227-59584249 AAGTACAAACTGAAATTGTTGGG - Intergenic
1110110370 13:71737601-71737623 CAGTAACTACTGAAGGTTTTTGG + Intronic
1110804685 13:79740384-79740406 GAGTAACAACTAACCTTGTTTGG + Intergenic
1111386451 13:87535135-87535157 TAGTAAAAAAAGAAGTTGTTGGG + Intergenic
1112929994 13:104722341-104722363 CAGTAATAACTGATATTATTAGG - Intergenic
1113283789 13:108822547-108822569 CAGTAACATCTGAACACGTTTGG - Intronic
1116111691 14:40593111-40593133 CAATATCAACTGAATCTGTTAGG + Intergenic
1119130020 14:72163582-72163604 CAGTAAAAAATGGAGTTGTGAGG + Intronic
1119956265 14:78801656-78801678 CAGAAACATCTGATGTGGTTTGG - Intronic
1121704443 14:95981149-95981171 GAGTAAAAACTGAAGTTCTCTGG - Intergenic
1122857878 14:104568583-104568605 CAGGAAGAACTGAGGTCGTTTGG + Intronic
1123153424 14:106203657-106203679 CTGAGACAACTGAAGTTGTCCGG - Intergenic
1126188021 15:45849441-45849463 CAGGAACAACTGAAGCAATTTGG + Intergenic
1133441179 16:5822191-5822213 CAGTGACAACATAAGATGTTTGG - Intergenic
1138371759 16:56532632-56532654 CAGTAATAAATGAAATTGATGGG + Intergenic
1140834545 16:78781100-78781122 CAGAAACAACAGCATTTGTTTGG - Intronic
1144543139 17:16165668-16165690 TAGTAGCAACTGAAGTTCCTAGG - Intronic
1145301321 17:21640650-21640672 TAGTAGCAACTGAAGTTCCTAGG + Intergenic
1145348980 17:22062652-22062674 TAGTAGCAACTGAAGTTCCTAGG - Intergenic
1149090619 17:52773919-52773941 CAGTCACAACTGTATTTGCTTGG - Intergenic
1151194003 17:72419096-72419118 CATTGGCAACTGCAGTTGTTGGG - Intergenic
1151508047 17:74542181-74542203 CAACAACCACTGAAGTTGTAGGG - Intronic
1158848677 18:61472004-61472026 CAGTAAGAGCTAAAGTTCTTTGG - Intronic
1159764884 18:72477057-72477079 CAGCCACAACTAAAATTGTTAGG - Intergenic
1164388586 19:27796864-27796886 CAGTTGAAACTGAAGTAGTTAGG - Intergenic
929506141 2:42529736-42529758 CATTAACAACTTCAGTTGTAGGG - Intronic
931921205 2:67017853-67017875 CAGTAGCAACTTAAATTTTTAGG + Intergenic
932491237 2:72122882-72122904 CAGTAAAAACTGAAGATGAAAGG + Intergenic
934045960 2:88172685-88172707 CAATAACCATTGAAGATGTTTGG + Exonic
934050853 2:88209640-88209662 GAGGAAGAACTGAAGGTGTTTGG - Intergenic
935870690 2:107446011-107446033 CAGAGAGAACTGAAGTTGTAGGG + Intergenic
936872630 2:117150762-117150784 CAGTAGTAACTGAAAGTGTTAGG - Intergenic
937724219 2:125141561-125141583 CAGTAGCAATTGAAGTTATAAGG + Intergenic
938003581 2:127768231-127768253 CAGTAACAACAAAATTTGTTCGG - Exonic
941632650 2:167901941-167901963 CAGTAAACACTGAAGTTATCTGG + Intergenic
944898146 2:204187175-204187197 CAGTAACTACTGTTATTGTTTGG - Intergenic
947638904 2:231695005-231695027 AAAAAATAACTGAAGTTGTTGGG + Intergenic
1170854553 20:20039195-20039217 CAGTGACAACAGAAGTTGCAAGG + Intronic
1173349294 20:42230480-42230502 ACTGAACAACTGAAGTTGTTGGG + Intronic
1176018335 20:62949904-62949926 GAGTAACAACTGAAGGTGAGTGG + Intergenic
1177400873 21:20603937-20603959 CAGTAACAATTCACATTGTTTGG - Intergenic
1178514694 21:33236627-33236649 CAGTAGCAGCAGCAGTTGTTAGG + Intronic
1181139623 22:20794911-20794933 CAGTTACAACAGAAGCTGTATGG + Intronic
960273997 3:115706139-115706161 CAGGAAGTACTGAAGTTATTTGG - Intronic
965296183 3:166949684-166949706 GAGTAAGAACAAAAGTTGTTTGG + Intergenic
965688406 3:171329785-171329807 CATGAACAACTGAAGTTGCAAGG + Intronic
966390145 3:179443801-179443823 AATTAATAACTGAAGTTATTTGG + Intronic
972872408 4:43315991-43316013 CAATTACAAATGAGGTTGTTAGG + Intergenic
973107484 4:46358173-46358195 CATTAATAACACAAGTTGTTTGG - Intronic
973155208 4:46943269-46943291 CAGAAACAGCTGAAGTTTTGTGG - Intronic
975431093 4:74291843-74291865 CACTGAAAACTGAAGTGGTTGGG - Intronic
977099554 4:92793362-92793384 CAGTAACAGTTGAAGTGTTTGGG + Intronic
980821055 4:138018632-138018654 CAGAAACAACTCAAGATGTATGG + Intergenic
982080086 4:151780938-151780960 AAATAATAACTGAAGTTCTTGGG - Intergenic
983185618 4:164697189-164697211 AAGTAAGAAATGAAGTGGTTGGG - Intergenic
983807039 4:172006677-172006699 AAGTAAAAACTAAAGTTCTTGGG + Intronic
985497916 5:220297-220319 CAGTAACTATTGAAGTTTCTTGG - Intronic
986066930 5:4243487-4243509 CAGTAACAACTGATACCGTTTGG - Intergenic
987438366 5:17925666-17925688 CAGTTACTACTGAAGCTGCTGGG + Intergenic
987585722 5:19853587-19853609 CAGAAGCAACTGAAGTTATTAGG + Intronic
987729061 5:21744191-21744213 CTGTAATAATGGAAGTTGTTAGG + Intergenic
994523199 5:100868552-100868574 CTGAAACTACTGAAGATGTTTGG - Intronic
994569459 5:101496764-101496786 CACTAACAATTGATGTTGTTAGG - Intergenic
995808351 5:116079142-116079164 CAGTAAAGACTGAAGCAGTTAGG + Intergenic
996941246 5:129008329-129008351 CTGTATCAACTGAATTTCTTAGG + Intronic
1000079079 5:157827715-157827737 TGGTAACCACTGAAGTTGTAAGG - Intronic
1000803460 5:165758300-165758322 CAGTAACAACTAATGCTGATAGG - Intergenic
1003239139 6:4327390-4327412 AAGAACCAACTGAAGTTATTGGG + Intergenic
1008757721 6:54817549-54817571 CAGTATCAACTAGAGTAGTTTGG - Intergenic
1010150979 6:72732107-72732129 CTGTACCAACTGTACTTGTTGGG - Intronic
1011595922 6:89015993-89016015 CAATAACAAATGAAATTGCTGGG - Intergenic
1012646322 6:101686926-101686948 TATAAACAACTAAAGTTGTTTGG - Intronic
1013207058 6:107954823-107954845 CAGAAACAACTCAAGTTATTAGG + Intronic
1013303090 6:108822376-108822398 CAAGAAGAACTGAAGCTGTTTGG - Intergenic
1013515084 6:110877331-110877353 CAGTGACCACTCAAGTGGTTAGG + Intronic
1013581575 6:111540107-111540129 CAGTAAGAACTTAAATTGTCAGG - Intergenic
1013740896 6:113283428-113283450 AAGTAACAACAGATGTTGTGAGG + Intergenic
1015130794 6:129806880-129806902 CAGTAACAACAGAACTTTTTGGG + Intergenic
1016392103 6:143585035-143585057 CTGTCATAACTCAAGTTGTTGGG + Intronic
1018204219 6:161421962-161421984 AAAGAACAACTGAAGTTCTTTGG + Intronic
1021403196 7:20233792-20233814 CAGAAACAACTGATGCTTTTTGG + Intergenic
1021668326 7:23011003-23011025 CAGTGACCACTGAATTTGTCAGG - Intronic
1023266824 7:38415073-38415095 CAGTAAAATTTGATGTTGTTGGG + Intronic
1023661360 7:42474367-42474389 CAGTATCAGCTGAAGTTATAGGG + Intergenic
1025278732 7:57609386-57609408 TAGTAGCAACTGAAGTTCCTAGG + Intergenic
1027629721 7:80587793-80587815 CATTCAGAACTGAAGTTGTAAGG + Intronic
1029215789 7:98948480-98948502 CAGTAACAAGGGACCTTGTTAGG + Intronic
1030155668 7:106451887-106451909 GAGGAACAACTAAAGTTTTTTGG + Intergenic
1035664135 8:1367907-1367929 CCGGAACAACTGAGCTTGTTCGG - Intergenic
1045732521 8:105258463-105258485 CAGAAACAACAGATGTTGTCAGG - Intronic
1047469529 8:125155933-125155955 CAGTAATCTCTGAACTTGTTGGG - Intronic
1047771153 8:128031147-128031169 AAGTAACACCTGGAGTGGTTAGG + Intergenic
1052004082 9:23325233-23325255 CAGTAGAAACTGGAGTTGTTTGG - Intergenic
1054839598 9:69722403-69722425 TACTCACAACTGAAGTTGATAGG + Intronic
1057056688 9:91967074-91967096 CAGTAACAACTAAAATTTATTGG + Intergenic
1060407646 9:123380823-123380845 CAGAATCAACTGAAGTTTTGGGG + Exonic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1185715615 X:2339622-2339644 CAGTGACAACAGACGATGTTTGG + Intronic
1186785306 X:12951403-12951425 CAGTAACAGCTGTTGTTTTTAGG - Intergenic
1194302050 X:92200568-92200590 AAGTAACAACTGAACATCTTTGG + Intronic
1194440119 X:93921892-93921914 CAGTACAAAATTAAGTTGTTTGG + Intergenic
1196368309 X:114947299-114947321 CAGCCACAACTGGAGTCGTTGGG + Intergenic
1197495918 X:127179507-127179529 CAGTAACAATTGAAAATGATAGG - Intergenic
1200366416 X:155670334-155670356 TAGTATCCACTCAAGTTGTTTGG + Intergenic
1201388986 Y:13476220-13476242 CAATAACAACTCTAATTGTTTGG + Intronic