ID: 911780523

View in Genome Browser
Species Human (GRCh38)
Location 1:101870290-101870312
Sequence ATGATGTTATTGATGAATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911780523_911780529 30 Left 911780523 1:101870290-101870312 CCATAATTCATCAATAACATCAT 0: 1
1: 0
2: 2
3: 23
4: 262
Right 911780529 1:101870343-101870365 ACAGTTTTAGCTACAGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911780523 Original CRISPR ATGATGTTATTGATGAATTA TGG (reversed) Intronic
901253513 1:7800195-7800217 ATGAAGTGATTGATATATTAGGG - Intronic
901924249 1:12555766-12555788 ATAAAGATATTGATGAATAACGG + Intergenic
904355661 1:29937537-29937559 ATGATGATGATGATGAATAATGG + Intergenic
904881656 1:33702326-33702348 ATGATGCTATTAAGAAATTATGG + Intronic
904974341 1:34444347-34444369 ATAATGTTAGTGCAGAATTAGGG - Intergenic
906043897 1:42812546-42812568 AGGATGTTACTGATGATTCAAGG - Intronic
906849001 1:49227426-49227448 ATGACTTTTTTGATGAATCAGGG - Intronic
909150177 1:71992574-71992596 ATAAAGTTATTGAGGTATTATGG + Intronic
909849606 1:80443889-80443911 ATCATGTTATTGGCAAATTAAGG - Intergenic
910523457 1:88150351-88150373 ATAATGTTAGTGATTAAGTAAGG - Intergenic
910814349 1:91274585-91274607 ATGATGTTATTGCTTCACTATGG + Intronic
911247722 1:95537042-95537064 TTGAAGTTATTGATCAATTTTGG - Intergenic
911780523 1:101870290-101870312 ATGATGTTATTGATGAATTATGG - Intronic
912126477 1:106545167-106545189 ATGCTATTACTGATGAATTCTGG - Intergenic
912956723 1:114159143-114159165 ATGGTGTCATTGATAAAATACGG + Intergenic
914980276 1:152409253-152409275 AAGGTTTTATTGATGCATTAGGG + Exonic
915618691 1:157064455-157064477 CTAATGTAAATGATGAATTATGG - Intergenic
917396377 1:174598906-174598928 ATATTGTTATTGATAAACTAAGG + Intronic
917545123 1:175958073-175958095 ATGTTGTTATAACTGAATTAAGG + Intronic
917770520 1:178272370-178272392 CTTATTTTATTTATGAATTAAGG + Intronic
918416639 1:184315975-184315997 ATGAAGTTCTCTATGAATTATGG - Intergenic
921983239 1:221281331-221281353 GTTATGTTATTTATAAATTATGG + Intergenic
922382859 1:225050445-225050467 ATGAATTTATTGAAAAATTAGGG + Intronic
1063731132 10:8698344-8698366 ATAATGTTATTAAGGAATTTTGG - Intergenic
1064830285 10:19457073-19457095 ATGATGGTGTTGATGAGTGATGG - Intronic
1065068340 10:21997169-21997191 ATGATTTCATTCATGAATGATGG - Intronic
1065165786 10:22975644-22975666 ATGATTTTTTTGCTGTATTAAGG + Intronic
1067121999 10:43480935-43480957 ATGATATTCTAGATGAATAAAGG + Intronic
1068123996 10:52815231-52815253 ATAATGTTGTTGATAATTTAGGG + Intergenic
1068978824 10:63039081-63039103 ATGTAATTATTGATGTATTAGGG - Intergenic
1069052259 10:63808370-63808392 ATGAGGTTATTAATTAATAATGG + Intergenic
1069372823 10:67765398-67765420 ATGATGTTAATGATGTGTGAGGG + Intergenic
1070913580 10:80138401-80138423 ATGGTGTTATTGCTGAATCTGGG - Intronic
1071133416 10:82423460-82423482 ATCAAGTGATTGATCAATTAAGG - Intronic
1072727063 10:97821397-97821419 ATGAAGTTAGTGCTAAATTAAGG - Intergenic
1074339910 10:112618355-112618377 ATGATGATGTTGATGAGGTAGGG - Intronic
1076552422 10:131290713-131290735 ATGATTTTATTCATGACTGAAGG + Intronic
1078712509 11:13808135-13808157 CTCATGTTATTAATGAATTATGG + Intergenic
1083447274 11:62716788-62716810 TTGTTGTTGTTGAAGAATTATGG + Intronic
1086071484 11:82804318-82804340 TTGATGATATTGAGGAATTATGG + Intergenic
1086739626 11:90351621-90351643 GTTGTGTTATTGATGCATTATGG + Intergenic
1088158026 11:106832799-106832821 ATAATGTTTATGATAAATTAGGG - Intronic
1089027579 11:115287918-115287940 ATGATGTTATTGTCTATTTATGG - Intronic
1089971981 11:122701210-122701232 AGGATGTTATTGATTGATTTTGG + Intronic
1090216975 11:124976842-124976864 ATGGTGATAATGATGAATTCAGG + Intronic
1093549987 12:20397906-20397928 ACGATCTTATTGATTAAATAAGG + Intronic
1095210091 12:39483750-39483772 AAAATGTTACTGATGAATCATGG + Intergenic
1095403950 12:41846559-41846581 ATGATTTAATGAATGAATTAAGG + Intergenic
1095508736 12:42926428-42926450 ATGATGTCATTGACTGATTAGGG + Intergenic
1096615671 12:52831963-52831985 ATGATTTTAATGCAGAATTAGGG - Intronic
1098075396 12:66724446-66724468 ATGATGTATTTGATGAAATAAGG - Intronic
1098272890 12:68786093-68786115 ATGAATTAATTAATGAATTAAGG + Intronic
1098582705 12:72120024-72120046 ATGCTATTATTGATAAAGTAAGG + Intronic
1099177814 12:79441953-79441975 ATGATGTTATTAATGCCTTGGGG - Intronic
1099418058 12:82418605-82418627 ATGATGTTATTCAAGGTTTATGG - Intronic
1100121231 12:91371510-91371532 ATGATTTTATTTGTAAATTATGG + Intergenic
1102187549 12:110960989-110961011 CAGATGTGATTGATGACTTAAGG - Intergenic
1106590693 13:31096092-31096114 ATAATGTTATTTATAAATTTGGG - Intergenic
1107199145 13:37692388-37692410 GTGTTCTTATTGATGAATTGAGG - Intronic
1107260366 13:38483129-38483151 ATGATATGATTGCAGAATTAGGG + Intergenic
1108089652 13:46835219-46835241 ATGATGTTTGTGATGAAGAAAGG + Exonic
1108265625 13:48705408-48705430 ATGTAATTATTGATGAATGAGGG + Intronic
1108944619 13:56005769-56005791 ATGAGGATATTTATGAAATAAGG - Intergenic
1108979080 13:56487559-56487581 AAGTTGTTATTGAAGACTTAAGG + Intergenic
1109656885 13:65404169-65404191 ATGATTTTATTAATAAAATAAGG + Intergenic
1109729239 13:66389121-66389143 ATGATTTTATTCATAAAATAAGG - Intronic
1110518714 13:76448209-76448231 TTGATTTTAGTGATGACTTATGG + Intergenic
1111446585 13:88353389-88353411 TTTATGCTAGTGATGAATTAAGG + Intergenic
1111633879 13:90878532-90878554 AACATGATATTGTTGAATTATGG + Intergenic
1112278999 13:98046396-98046418 ATGATGATATTTATGCATTTTGG - Intergenic
1112306169 13:98276188-98276210 TTGATGTAATTGATGAAATGAGG + Intronic
1113195649 13:107802424-107802446 ATCATATTATTTATAAATTATGG + Intronic
1114607990 14:24013638-24013660 ATGAGGCTATTGAACAATTAAGG - Intergenic
1115025271 14:28737501-28737523 ATGAAGTTATTCAGGAATTAAGG - Intergenic
1116425523 14:44785403-44785425 ATGATGTTTTAGATTAAGTAAGG - Intergenic
1116674306 14:47885972-47885994 TTGATGTTATTCATGACTTTTGG + Intergenic
1117185401 14:53234661-53234683 ATGACGTTATTGAAGAATGGTGG - Intergenic
1117395368 14:55304290-55304312 ATGATGGTGTTAATGAATTAAGG - Intronic
1117809711 14:59533618-59533640 ATTATGATATTTTTGAATTATGG - Intronic
1120839035 14:89066939-89066961 AGGATGTGATCGATGAATTAAGG - Intergenic
1125187407 15:36947149-36947171 ATTAGGTGATTGATGATTTATGG + Intronic
1126851109 15:52797860-52797882 ATGATGTTAATGATGGAAAAAGG + Intergenic
1129144838 15:73637279-73637301 ATGATTATAATGATGAATCATGG - Intergenic
1131243549 15:90770129-90770151 ATTTTGTTACTGAAGAATTATGG - Intronic
1135379186 16:21979857-21979879 ATGATGTTTTTGGTCAATGATGG - Intronic
1136081485 16:27855120-27855142 ATGGTGGAATTGATGAATGAGGG + Intronic
1138921267 16:61532132-61532154 ATTCTGTTTTTGATGATTTATGG + Intergenic
1139048456 16:63092790-63092812 ATGATCCTATTGAGAAATTAAGG - Intergenic
1139275216 16:65721071-65721093 ATGATTTTATTGATGATTCCTGG - Intergenic
1146241606 17:31233943-31233965 ATGATGTTAGAGATGAGGTAGGG - Intronic
1146804751 17:35856242-35856264 AGTATGTTATAGTTGAATTAAGG + Intronic
1147004800 17:37393959-37393981 TTGAAGTTATTAATGGATTAGGG - Intronic
1149635624 17:58166688-58166710 ATGGTATTATTCATGAAGTAAGG + Intergenic
1150998476 17:70346501-70346523 ATGCTGTTATTGTTTTATTAAGG + Intergenic
1157390978 18:47303174-47303196 ATGAGGTTGATGATAAATTAGGG + Intergenic
1158731198 18:60024590-60024612 ATGATGTTATTCAAGGTTTATGG - Intergenic
1158861409 18:61595665-61595687 TTGATTTGATTGATGAACTAAGG + Intergenic
1159328661 18:66958466-66958488 ATGGTGTTATTGAGGTATAATGG - Intergenic
1159832734 18:73297640-73297662 ATGATGAAATTTATGAATTTAGG + Intergenic
1160296806 18:77645999-77646021 ATGATGACAGTCATGAATTAAGG - Intergenic
925679489 2:6403758-6403780 TTCATGGTATTGAAGAATTAGGG + Intergenic
927219721 2:20695833-20695855 ACCATTTTATTGATGAATAAAGG + Intronic
928895971 2:36263899-36263921 ATGAGGTTATTGTTGAAATCAGG - Intergenic
930187180 2:48421722-48421744 ATAATGTTTTTGATGAAATAAGG - Intergenic
930225714 2:48790521-48790543 ATGATCTGATTAATGAATTGTGG - Intergenic
931163701 2:59722097-59722119 ATGTTTTTATTGAAGAATTTGGG - Intergenic
931612765 2:64121440-64121462 AAGATGTTAATGATGATATAAGG - Intronic
931660024 2:64551539-64551561 ATGATGATGATGATGAATTTGGG + Exonic
936133065 2:109863947-109863969 AATATGTAATTGATGTATTAGGG - Intergenic
936211632 2:110507538-110507560 AATATGTAATTGATGTATTAGGG + Intergenic
936420770 2:112362115-112362137 AATATGTAATTGATGTATTAGGG + Intergenic
936559571 2:113525217-113525239 ATGATGTGTTTGATCATTTATGG + Intergenic
936702429 2:115029055-115029077 GTGTTATTATTGATGAATAAAGG + Intronic
938265985 2:129928640-129928662 ATGGTGTTATTGCTGAATCTGGG + Intergenic
941045200 2:160667114-160667136 CTGATGTTATTTAAAAATTATGG + Intergenic
942195684 2:173517119-173517141 ATAATGGCCTTGATGAATTAAGG + Intergenic
942783509 2:179673419-179673441 ATGAAATAATTGAAGAATTATGG + Intronic
942835221 2:180287330-180287352 ATGAAGTTATTGATAGATGATGG + Intergenic
943506366 2:188764553-188764575 AAGATGTTATTGACCAAATAGGG - Intronic
943529388 2:189060064-189060086 ATGATGATAATGATGAAGGAGGG - Intronic
944127967 2:196315729-196315751 CTTATGTCATTTATGAATTATGG + Intronic
944266958 2:197738397-197738419 AAGATGTTACTGCTGAATTAGGG + Intronic
947310931 2:228801052-228801074 AAGATATTATTTAGGAATTATGG + Intergenic
948749290 2:240121527-240121549 ATGCTTTTATTGTTGATTTATGG + Intergenic
1169158051 20:3350957-3350979 AGGATCTAATTAATGAATTAAGG + Intronic
1169923899 20:10763195-10763217 ATGATATTTTTGATGAATACAGG + Intergenic
1173153984 20:40592445-40592467 ATGTTGTGATTGATGAATGTAGG + Intergenic
1174947150 20:55000240-55000262 CAGATGTTATTCAAGAATTAAGG - Intergenic
1176702767 21:10077053-10077075 ATGCTAATATTGATGAATTTTGG + Intergenic
1177386457 21:20415372-20415394 ATGATATCACTGATGAATTTTGG + Intergenic
1178135616 21:29623632-29623654 TTGAGGTTATTCATGAAATAAGG - Intronic
1179094241 21:38297673-38297695 AGGATATAATTGATGAACTAGGG - Intronic
1184951582 22:47846533-47846555 ATCATGGAATTGATGAAATATGG + Intergenic
952567078 3:34671869-34671891 ATGTTATTATTGATGAGTTAAGG - Intergenic
953069732 3:39507141-39507163 TTAATGTCAATGATGAATTAAGG - Intronic
953203881 3:40803452-40803474 ATGATGTTATTCAAGGTTTATGG - Intergenic
953246161 3:41195644-41195666 ATGATTTTTTCGATGAATTTAGG + Intronic
953687124 3:45086714-45086736 ATGGTGTTATTGAAGAACTCTGG - Intronic
954499240 3:50994962-50994984 ATGATTTTCTTAATGAATTATGG + Intronic
955630813 3:60972596-60972618 TTGATGTTATTCATTAATTTTGG + Intronic
955640051 3:61072641-61072663 ATAATGTTGTTGCTGAATTCTGG + Intronic
956011880 3:64840744-64840766 ATGATCTTATTGTTAACTTATGG - Intergenic
957154216 3:76526814-76526836 ATGATGTTATGAATGTATAATGG + Intronic
958718741 3:97820433-97820455 AGGATTTAATTAATGAATTATGG - Intergenic
959868057 3:111293431-111293453 TTTATGTTATAGATGAAGTATGG + Intronic
960788743 3:121402687-121402709 TTGAAGTTAGTGATGATTTATGG - Intronic
962502526 3:136009761-136009783 ATGATTTTAGTGACGAATTATGG - Intronic
962693470 3:137924906-137924928 ATGATATTATTAATGAGGTAAGG - Intergenic
964013262 3:151916516-151916538 ATGAAGATATTAATGTATTAAGG + Intergenic
964642116 3:158919712-158919734 ACGATGTTATCAATGAATAATGG + Intergenic
964799304 3:160536799-160536821 ATGAAGTTGTAGTTGAATTAAGG - Exonic
967359387 3:188612271-188612293 ATGAAGTTATGGATAAATTCTGG + Intronic
967566128 3:190975319-190975341 ATGATGTTATTCAAGTTTTATGG - Intergenic
967706548 3:192657765-192657787 ATGGTTTTATTGATAAATTTGGG - Intronic
968004635 3:195233368-195233390 ATGTTATTATTGATTAAGTAAGG + Intronic
969181851 4:5448175-5448197 ATTATGTTTTTGAGGAATTCAGG - Intronic
969972140 4:11058800-11058822 CTGATGTCCATGATGAATTAGGG - Intergenic
971447250 4:26764229-26764251 ATTATATTATTGATGAAGTCGGG + Intergenic
971522654 4:27574055-27574077 ATGACTTTATTGATGTACTAAGG + Intergenic
971635886 4:29057057-29057079 ATAATGGTTTTGATGAATTCAGG - Intergenic
972073119 4:35048033-35048055 ATCATGCTATTGAAGAATTTAGG + Intergenic
972087013 4:35230500-35230522 ATGATGGTAATGATGAGATATGG + Intergenic
972461309 4:39305771-39305793 ATTATATTTTTTATGAATTAAGG - Intronic
973143126 4:46793359-46793381 GAGATGTTATTTATGATTTATGG + Intronic
973886171 4:55324318-55324340 AAGATGTTATTGATAGATCATGG - Intergenic
974003392 4:56532482-56532504 ATGATGGTACTGATTAATTAGGG - Intronic
974161389 4:58145200-58145222 ATCATATTATTCATGACTTAAGG - Intergenic
974499561 4:62683307-62683329 ATAATGTTATTGGTTAATGAGGG + Intergenic
974575325 4:63712316-63712338 ATGATGTAATAAATAAATTAGGG + Intergenic
974777320 4:66502063-66502085 ATGATGTCAGTAATAAATTAAGG - Intergenic
975563760 4:75732519-75732541 ATAATGTTTTTAATGAAATAAGG - Intronic
975832578 4:78385327-78385349 ATCATGTTATTCATGATTCAAGG + Intronic
976988581 4:91334382-91334404 ATGAACTTTTTAATGAATTAGGG - Intronic
977814551 4:101399401-101399423 ATGATATTGTTGATAAATTCTGG + Intergenic
980105796 4:128587194-128587216 ATGATGTGATTGTTCAAATAAGG + Intergenic
980205052 4:129707587-129707609 ATGATGATATGAATCAATTATGG + Intergenic
980374955 4:131933431-131933453 ATGCTAATATTGATGAATTTTGG + Intergenic
980514308 4:133834037-133834059 ACTATGTTACTTATGAATTACGG - Intergenic
981423477 4:144577830-144577852 AAGATATTGTTGATGAAATATGG + Intergenic
981598718 4:146458936-146458958 ATGATGTAATTTGTGAATAAAGG - Intronic
981610849 4:146591997-146592019 AAAATGTTAGTGATGAATTGAGG + Intergenic
981742978 4:148022434-148022456 ATGACTTTATTGAAGAATGAAGG + Intronic
981904887 4:149911320-149911342 CTAATGTAAGTGATGAATTAAGG - Intergenic
982031524 4:151306576-151306598 ATGAAGTTAATGAAGAATTGGGG - Intronic
982818133 4:159911793-159911815 ATTATGTCATAGAGGAATTATGG - Intergenic
982990473 4:162267488-162267510 ATTATCTTTTTGATGTATTATGG + Intergenic
984692776 4:182746868-182746890 ATCATGTCATTGATAAAATAGGG + Intronic
985033522 4:185816206-185816228 GTGATGATTTTGTTGAATTAAGG - Intronic
985810234 5:2077946-2077968 ATGCTGTGATTGATGAAATTTGG + Intergenic
987532272 5:19136652-19136674 ATGAAGTAAATGATGAATTTTGG + Intergenic
988133838 5:27142270-27142292 ATGAGGTTAATTAGGAATTAAGG - Intergenic
989806133 5:45608294-45608316 ATGAATTTATTGATACATTAGGG - Intronic
990326199 5:54678009-54678031 ATAATTTTACTCATGAATTAAGG + Intergenic
991115511 5:62950138-62950160 AAGATGTTATTGAGGAAGAAAGG - Intergenic
992106994 5:73457675-73457697 ATGATATCATTAATTAATTAAGG - Intergenic
994132829 5:96250149-96250171 ATGTTGTGATTGATGAACTTTGG + Intergenic
994691028 5:103019669-103019691 ATAATGCATTTGATGAATTAAGG + Intronic
996281889 5:121739846-121739868 ATAATGTTATAGTTGAAATAGGG - Intergenic
996668890 5:126093356-126093378 ATTATATTATTGATGAATAACGG - Intergenic
996914568 5:128696882-128696904 ATGCTGATATTGTTGAATTTGGG + Intronic
999096439 5:148982051-148982073 ATGATGTCAATAATGAATTTGGG + Intronic
999412449 5:151363773-151363795 ATGGTGTTATTCAAGATTTATGG + Intergenic
999595744 5:153202202-153202224 ACCATATAATTGATGAATTATGG - Intergenic
999942337 5:156557386-156557408 ATGTGGTTATTCATGAATTTGGG + Intronic
1000591348 5:163161826-163161848 ATTATATTATTTATGATTTATGG - Intergenic
1004734430 6:18391204-18391226 ATGATGTAATTGACCAATCAAGG - Intronic
1005925478 6:30441538-30441560 ATGATGTTAGCTATGAATTGTGG - Intergenic
1007635210 6:43295785-43295807 CTGATGTCATTGAAGAATGATGG - Intronic
1008029306 6:46675402-46675424 ATGATGACATAGATGAAATAAGG - Intronic
1008370068 6:50721890-50721912 ATGATGTTCTTGAAGAAATATGG + Intronic
1009502526 6:64433250-64433272 ATTTTGTTATTGTTGAAATATGG - Intronic
1009564067 6:65287990-65288012 ATGAAATTATTGATGAAATCAGG - Intronic
1009813781 6:68704211-68704233 ATGATGTTATTGAAGCATCTAGG + Intronic
1010562899 6:77372412-77372434 CTTATTTTATTGATGAATCATGG - Intergenic
1012708959 6:102572992-102573014 ATGATTCTAGTGATGAATGAGGG + Intergenic
1012882698 6:104810146-104810168 ATGATATTATTCATAAATTCAGG + Intronic
1012945137 6:105457730-105457752 ATGATGATATTCATGAATCTTGG - Intergenic
1015233845 6:130947896-130947918 ATTAGGATATTGATGAATTATGG + Intronic
1015471234 6:133608841-133608863 ATGCTGTTATTCATGGTTTACGG + Intergenic
1015590280 6:134816484-134816506 ATGATGTTAATGATGACTCATGG + Intergenic
1016284756 6:142461124-142461146 ATCATGGTATCGATGCATTATGG - Intergenic
1016865006 6:148757474-148757496 ATGATGTGATTTTTGAAATAGGG + Intronic
1017056363 6:150439730-150439752 ATGATGTTATTCAAGGTTTATGG - Intergenic
1017328136 6:153163884-153163906 ATCATGATATTGCTGAATTTTGG + Intergenic
1018227735 6:161645692-161645714 GTGATTTCATTGATAAATTAAGG - Intronic
1020748867 7:12113326-12113348 TTGATTTTGTTGATGAAGTACGG - Intergenic
1021558753 7:21947349-21947371 ATAATGTTATTTATTCATTATGG + Intergenic
1024409041 7:49017433-49017455 ATGATGTTATTGATATATTATGG - Intergenic
1024958738 7:54952968-54952990 ATGATTTTATTATTAAATTAGGG + Intergenic
1025718475 7:63986207-63986229 ATGTTGTTATTGATAAGTGAAGG - Intergenic
1026616657 7:71911063-71911085 TTGATTTTACTGATGAATTTGGG - Intronic
1028042100 7:86065520-86065542 ATGATGTTATTTATAAAGTTGGG - Intergenic
1028206960 7:88029088-88029110 ATGTTATTATTGATAAATAAGGG + Intronic
1028277811 7:88879476-88879498 ATGAAGTTATTCAAGAAGTATGG + Intronic
1028778720 7:94709719-94709741 ATGATATTATTGTGGAAGTAAGG - Intergenic
1028959091 7:96728716-96728738 GCGTTGTTATTGATTAATTATGG - Intergenic
1029823105 7:103163431-103163453 ATGATGTTAATGATATTTTACGG + Intergenic
1031566234 7:123300179-123300201 ATGTTATTATTGATAAATAAAGG - Intergenic
1031721616 7:125183509-125183531 ATGAGGTAAATGATGAATTGAGG + Intergenic
1031889372 7:127276276-127276298 ATGATGTTATTCAAGGTTTATGG - Intergenic
1032030924 7:128483149-128483171 TTGATGATATTGATGATTAATGG - Intronic
1032926102 7:136606846-136606868 ATGATGGTATAAATGAATCAAGG + Intergenic
1037296556 8:17408081-17408103 ATGATGTTCTTGCTGATTGATGG - Intronic
1038200289 8:25406420-25406442 ATGATGTAATTATTGTATTATGG - Intronic
1038502463 8:28057070-28057092 ATGGTGTTATTCAAGATTTAGGG - Intronic
1038722618 8:30050711-30050733 ATGATGTTATTCAGGAATTCTGG - Intergenic
1040618130 8:49060897-49060919 ATGATGTAATTGATGAAGAAAGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041646447 8:60257531-60257553 ATGATGTAGTTGGTGAATTTAGG - Intronic
1043219649 8:77644135-77644157 ATAATTTTATTAATGTATTATGG + Intergenic
1044044031 8:87407389-87407411 ATGATGTTATTGATGGATATTGG + Intronic
1045362652 8:101447580-101447602 CTAATGTCTTTGATGAATTATGG - Intergenic
1045815916 8:106275755-106275777 ATGTTGTTCTTGTTGAATTCAGG + Intronic
1046482654 8:114842856-114842878 AGGATGCTATTTATAAATTAGGG - Intergenic
1046578350 8:116060116-116060138 ATCATTTTATAGATGATTTAGGG + Intergenic
1046786943 8:118277619-118277641 ATGATATTATTTAGGAATCAGGG + Intronic
1047650954 8:126920354-126920376 ATGATGTTATCTATGAGTTGTGG + Intergenic
1047676707 8:127210460-127210482 CAGATGTTATTGATGAATCATGG + Intergenic
1048141971 8:131803516-131803538 CTGATGTGATTAATGAATGAAGG + Intergenic
1048150953 8:131893247-131893269 AAAATGTTATTCATGACTTAGGG + Intergenic
1049893294 9:91006-91028 ATGATGTGTTTGATCACTTATGG - Intergenic
1051010652 9:12409416-12409438 ATGATATTAAAGATGAATGAAGG - Intergenic
1052722039 9:32183688-32183710 CAGATGTTATTGATGAATTAAGG + Intergenic
1053356016 9:37446215-37446237 ATGATGGTATTTGTGAATTTTGG - Intronic
1053639968 9:40063775-40063797 ATGCTAATATTGATGAATTTTGG + Intergenic
1053734507 9:41091063-41091085 ATGATGTGTTTGATCATTTATGG - Intergenic
1053766165 9:41401708-41401730 ATGCTAATATTGATGAATTTTGG - Intergenic
1054320719 9:63660090-63660112 ATGCTAATATTGATGAATTTTGG + Intergenic
1054544781 9:66312863-66312885 ATGCTAATATTGATGAATTTTGG - Intergenic
1057288855 9:93786935-93786957 AGGATGTTATTGAGCAATAAGGG - Intergenic
1059218639 9:112590832-112590854 ATAATGTGATTGATTGATTAAGG + Intronic
1202787788 9_KI270719v1_random:47161-47183 ATGCTAATATTGATGAATTTTGG + Intergenic
1185953943 X:4468418-4468440 GTCATGTAATTGATGAATAAAGG + Intergenic
1186066517 X:5772015-5772037 ATGATGTTATTAAGGAACTAAGG + Intergenic
1187790811 X:22948054-22948076 AAGAAGATATTGATGAATCAAGG - Intergenic
1188765665 X:34088369-34088391 AAGCTGTCATTGATAAATTAAGG + Intergenic
1189387229 X:40547070-40547092 ATGATGTCATTGTTGCTTTAGGG - Intergenic
1191728420 X:64306630-64306652 ATGAAGTTGTAGTTGAATTAAGG - Intronic
1191811576 X:65195161-65195183 ATGTTATTATTGATGAGTAAGGG + Intergenic
1194312778 X:92334543-92334565 ATGGTGTTATTGAAGGTTTATGG - Intronic
1195205294 X:102593605-102593627 ATGTGGTTATTAATGAATGAAGG - Intergenic
1196926946 X:120642779-120642801 ATGAGATTCTTGAAGAATTACGG + Intergenic
1198197271 X:134375739-134375761 CTGATGCTATTTATGAATTTTGG + Intronic
1199096656 X:143750143-143750165 TTGATGTTACTGATGAATTCTGG + Intergenic
1200621046 Y:5448682-5448704 ATGGTGTTATTGAAGGTTTATGG - Intronic
1202265180 Y:23010732-23010754 ATGATGTTATATATTGATTAGGG - Intergenic
1202418171 Y:24644474-24644496 ATGATGTTATATATTGATTAGGG - Intergenic
1202452615 Y:25025612-25025634 ATGATGTTATATATTGATTAGGG + Intergenic