ID: 911784682

View in Genome Browser
Species Human (GRCh38)
Location 1:101931622-101931644
Sequence GCATCTGCTCAGTATAGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911784682_911784683 -9 Left 911784682 1:101931622-101931644 CCATAGCTATACTGAGCAGATGC No data
Right 911784683 1:101931636-101931658 AGCAGATGCCTGATTATTAATGG 0: 1
1: 0
2: 1
3: 10
4: 179
911784682_911784687 -1 Left 911784682 1:101931622-101931644 CCATAGCTATACTGAGCAGATGC No data
Right 911784687 1:101931644-101931666 CCTGATTATTAATGGGAAGTGGG No data
911784682_911784684 -8 Left 911784682 1:101931622-101931644 CCATAGCTATACTGAGCAGATGC No data
Right 911784684 1:101931637-101931659 GCAGATGCCTGATTATTAATGGG 0: 1
1: 0
2: 0
3: 3
4: 104
911784682_911784688 12 Left 911784682 1:101931622-101931644 CCATAGCTATACTGAGCAGATGC No data
Right 911784688 1:101931657-101931679 GGGAAGTGGGAGAAGATAGAAGG 0: 1
1: 2
2: 6
3: 84
4: 808
911784682_911784685 -2 Left 911784682 1:101931622-101931644 CCATAGCTATACTGAGCAGATGC No data
Right 911784685 1:101931643-101931665 GCCTGATTATTAATGGGAAGTGG 0: 1
1: 0
2: 0
3: 47
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911784682 Original CRISPR GCATCTGCTCAGTATAGCTA TGG (reversed) Intronic
No off target data available for this crispr