ID: 911792356

View in Genome Browser
Species Human (GRCh38)
Location 1:102033614-102033636
Sequence AAACCCTGCTTCACAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911792356_911792358 20 Left 911792356 1:102033614-102033636 CCTATCTTTGTGAAGCAGGGTTT No data
Right 911792358 1:102033657-102033679 AACAAGATTATAGAGTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911792356 Original CRISPR AAACCCTGCTTCACAAAGAT AGG (reversed) Intergenic