ID: 911793832

View in Genome Browser
Species Human (GRCh38)
Location 1:102052724-102052746
Sequence CTCAAACATTTGGAGATAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911793826_911793832 8 Left 911793826 1:102052693-102052715 CCCTAGCCTTAAAAGTCATTCCA No data
Right 911793832 1:102052724-102052746 CTCAAACATTTGGAGATAGTTGG No data
911793825_911793832 9 Left 911793825 1:102052692-102052714 CCCCTAGCCTTAAAAGTCATTCC No data
Right 911793832 1:102052724-102052746 CTCAAACATTTGGAGATAGTTGG No data
911793828_911793832 2 Left 911793828 1:102052699-102052721 CCTTAAAAGTCATTCCAACAATA No data
Right 911793832 1:102052724-102052746 CTCAAACATTTGGAGATAGTTGG No data
911793824_911793832 18 Left 911793824 1:102052683-102052705 CCAAGGAAACCCCTAGCCTTAAA No data
Right 911793832 1:102052724-102052746 CTCAAACATTTGGAGATAGTTGG No data
911793827_911793832 7 Left 911793827 1:102052694-102052716 CCTAGCCTTAAAAGTCATTCCAA No data
Right 911793832 1:102052724-102052746 CTCAAACATTTGGAGATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911793832 Original CRISPR CTCAAACATTTGGAGATAGT TGG Intergenic
No off target data available for this crispr